Bij de ongelofelijke hysterie over Oekraïne, dat zelf 8 jaar lang burgers bombardeerde zonder dat iemand uit de westerse politiek en reguliere media ook maar enige aandacht schonken aan de meer dan 13.000 mensen die daardoor het leven hebben verloren (ofwel die werden vermoord door neonazi-bataljons van het Oekraïense leger), wordt eens en te meer duidelijk dat ‘het gros van’ de neoliberaal geregeerde westerse landen zonder meer racistisch is, overduidelijk te zien aan de ruimhartige opvang van vluchtelingen uit Oekraïne……*
Het is om kotsmisselijk van te worden als je ziet wat een aandacht de westerse politiek en media besteden aan de vluchtelingen uit Oekraïne, terwijl het ze hoegenaamd niets kan schelen dat er de laatste 10 jaar zo’n 20.000 vluchtelingen zijn verdronken in de Middellandse Zee…. Ook het feit dat gekleurde buitenlandse studenten het vluchten uit Oekraïne onmogelijk werd gemaakt, interesseerde die media en politiek geen zier……. Nee, een dood jongetje deed de massa een paar jaar geleden even ontwaken uit de consucoma…… Zelfs EU reddingsoperaties werden zover uitgekleed dat het zeker was dat daardoor vluchtelingen zouden verdrinken….. ‘Geweldig’ hè de EU??!!!
En dan te bedenken dat de meeste van deze vluchtelingen, als die in Turkije en Griekenland (waar in de Egeïsche Zee ook nog eens een groot aantal mensen is verdronken, waaronder dat dode jongetje) op de vlucht zijn geslagen voor de illegale oorlogen die het westen o.l.v. de VS voerde in hun moederland (terreur van enorm grote schaal)…… Dan zijn er nog de vluchtelingen die vanwege de droogte zijn gevlucht en nog vluchten, mensen die in feite het slachtoffer waren en zijn van de vooral door westerse landen veroorzaakte snelle klimaatverandering…..
Ondanks dat een groot deel van de westerse landen verantwoordelijk is voor miljoenen vluchtelingen, wil men er amper of geen opnemen in eigen land, nee die mensen moeten in de regio worden opgevangen, terwijl die regio overvoerd zijn met vluchtelingen……
Nee, nu witte Oekraïners op de vlucht slaan, is er ineens plek genoeg voor de vluchtelingen, die meteen ook nog allemaal extra’s krijgen, extra’s die er niet zijn voor ‘normale vluchtelingen……’
Neoliberalisme is al een ideologie die dicht tegen fascisme aanschurkt, tel daarbij racisme op en je bent nog een hele stap verder richting een stinkende ‘nieuwe wereldorde…….’ Waar de belachelijke ongrondwettelijke, burger- en mensenrechtenschendende maatregelen tegen het Coronavirus hebben laten zien, dat de democratie op elk moment in de koelkast kan worden gezet, althans wat er nog rest van die democratie….. Ook de digitale EU pas, waarin al je gegevens komen te staan ook medische (en waarmee men je bankrekening kan blokkeren), is een verdere stap richting een fascistische regeerde staat…… Grote voorstanders van die pas: D66, VVD, CDA, PvdA en GroenLinks….. (zeker niet stemmen op deze partijen!!)
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
* Terwijl men nog onlangs vluchtelingen liet doodvriezen voor de Poolse grens en zelfs op Pools grondgebied……..
Via het Linkedin account van Mario Ortiz Martinez vond ik de volgende productie waarin wordt uitgelegd dat het Pfizer vaccin het DNA van de lever aantast. Voorts wordt de Neurenberg Code aangehaald, waarin duidelijk is weergegeven dat het iedereen vrij moet staan om wel dan niet te kiezen voor een vaccinatie en gezien de tekst zit daar geen woord Spaans bij (overigens heeft de EU eerder laten weten tegen verpolichte vaccinatie te zijn, al is die mening intussen losgelaten door hare kwaadaardigheid von der Leyen, althans als ik me niet vergis):
“1. The voluntary consent of the human subject is absolutely essential.This means that the person involved should have legal capacity to give consent; should be so situated as to be able to exercise free power of choice, without the intervention of any element of force, fraud, deceit, duress, over-reaching, or other ulterior form of constraint or coercion.”
Deze tekst kom je hieronder nogmaals tegen en gezien de volledige tekst is het m.i. onverantwoord om je te laten vaccineren met het Pfizer vaccin. Maar lees de tekst en vorm je eigen oordeel. (zie alvorens tot vaccinatie over te gaan ook de berichten onder de door mij toegevoegde links en ook daarbij: vorm je eigen mening)
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
(als
je het Engels niet machtig bent, kopieer dan de Engelse tekst en plak
die in deze
vertaalapp,
de app werkt snel en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt kan je kiezen voor Nederlands)
Farma Medical-Marketing Projects, Medical & Farma 3D animation videos, Director Herr Zimmerman – Events & Music.
8 u •
Peter J. Merrick
• 3de+
Expert in Business Succession/Exiting Execution – Speaker – Author of The Business Novel – The King of Main Street
20 u • Bewerkt •
20 uur geleden
URGENT – BE IN FORMED – Please Read and Then Share
with Loved Ones: Study shows Pfizer COVID shot changes the liver cells
DNA according to Swedish researchers at Lund University – one of
Europe’s oldest and most prestigious research universities. These
findings are published in the current -March 2022- Issue of the
peer-reviewed journal – Molecular Biology.
***This first source full peer-reviewed article is included with this post below.***
ARTICLE
ABSTRACT: These researchers found that messenger RNA (mRNA)
from Pfizer’s COVID-19 gene therapy shot is able to enter
human liver cells and convert into DNA- combining with the human genome –
creating something – NEW – NEVER SEEN BEFORE!!!!!!
THIS IS CAUSE FOR ALARM – ARE HUMANS PATENABLE?
On
June 13, 2013 – the US Supreme Court ruled that DNA manipulated by
humans are eligible to be patented. This synthetic DNA is produced from
messenger RNA that serves as the instructions for making proteins in the
cell. Does this sound familiar? (i.e. – mRNA shots) – You can’t write
this stuff up.
Again, please read and then share this
document/article with as many people you care about as possible. Below
in the comments a link to a down loadable pdf has been provided.
FOOD FOR THOUGHT:
WHAT
IS INFORMED CONSENT – Point One of The Nuremberg Code – this is taken
directly from United States National Institutes of Health:
“1.
The voluntary consent of the human subject is absolutely essential. This
means that the person involved should have legal capacity to give
consent; should be so situated as to be able to exercise free power of
choice, without the intervention of any element of force, fraud, deceit,
duress, over-reaching, or other ulterior form of constraint or
coercion.”
Preclinical studies of COVID-19 mRNA vaccine BNT162b2, developed by
Pfizer and BioNTech, showed reversible hepatic effects in animals that
received the BNT162b2 injection. Furthermore, a recent study showed that
SARS-CoV-2 RNA can be reverse-transcribed and integrated into the
genome of human cells. In this study, we investigated the effect of
BNT162b2 on the human liver cell line Huh7 in vitro. Huh7 cells were
exposed to BNT162b2, and quantitative PCR was performed on RNA extracted
from the cells. We detected high levels of BNT162b2 in Huh7 cells and
changes in gene expression of long interspersed nuclear element-1
(LINE-1), which is an endogenous reverse transcriptase.
Immunohistochemistry using antibody binding to LINE-1 open reading
frame-1 RNA-binding protein (ORFp1) on Huh7 cells treated with BNT162b2
indicated increased nucleus distribution of LINE-1. PCR on genomic DNA
of Huh7 cells exposed to BNT162b2 amplified the DNA sequence unique to
BNT162b2. Our results indicate a fast up-take of BNT162b2 into human
liver cell line Huh7, leading to changes in LINE-1 expression and
distribution. We also show that BNT162b2 mRNA is reverse transcribed
intracellularly into DNA in as fast as 6 h upon BNT162b2 exposure.
Coronavirus
disease 2019 (COVID-19) caused by severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2) was announced by the World Health
Organization (WHO) as a global pandemic on 11 March 2020, and it emerged
as a devasting health crisis. As of February 2022, COVID-19 has led to
over 430 million reported infection cases and 5.9 million deaths
worldwide [1]. Effective and safe vaccines are urgently needed to reduce the morbidity and mortality rates associated with COVID-19.
Several
vaccines for COVID-19 have been developed, with particular focus on
mRNA vaccines (by Pfizer-BioNTech and Moderna), replication-defective
recombinant adenoviral vector vaccines (by Janssen-Johnson and Johnson,
Astra-Zeneca, Sputnik-V, and CanSino), and inactivated vaccines (by
Sinopharm, Bharat Biotech and Sinovac). The mRNA vaccine has the
advantages of being flexible and efficient in immunogen design and
manufacturing, and currently, numerous vaccine candidates are in various
stages of development and application. Specifically, COVID-19 mRNA
vaccine BNT162b2 developed by Pfizer and BioNTech has been evaluated in
successful clinical trials [2,3,4] and administered in national COVID-19 vaccination campaigns in different regions around the world [5,6,7,8].
BNT162b2
is a lipid nanoparticle (LNP)–encapsulated, nucleoside-modified RNA
vaccine (modRNA) and encodes the full-length of SARS-CoV-2 spike (S)
protein, modified by two proline mutations to ensure antigenically
optimal pre-fusion conformation, which mimics the intact virus to elicit
virus-neutralizing antibodies [3].
Consistent with randomized clinical trials, BNT162b2 showed high
efficiency in a wide range of COVID-19-related outcomes in a real-world
setting [5].
Nevertheless, many challenges remain, including monitoring for
long-term safety and efficacy of the vaccine. This warrants further
evaluation and investigations. The safety profile of BNT162b2 is
currently only available from short-term clinical studies. Less common
adverse effects of BNT162b2 have been reported, including pericarditis,
arrhythmia, deep-vein thrombosis, pulmonary embolism, myocardial
infarction, intracranial hemorrhage, and thrombocytopenia [4,9,10,11,12,13,14,15,16,17,18,19,20]. There are also studies that report adverse effects observed in other types of vaccines [21,22,23,24].
To better understand mechanisms underlying vaccine-related adverse
effects, clinical investigations as well as cellular and molecular
analyses are needed.
A recent study showed that SARS-CoV-2 RNAs can be reverse-transcribed and integrated into the genome of human cells [25].
This gives rise to the question of if this may also occur with
BNT162b2, which encodes partial SARS-CoV-2 RNA. In pharmacokinetics data
provided by Pfizer to European Medicines Agency (EMA), BNT162b2
biodistribution was studied in mice and rats by intra-muscular injection
with radiolabeled LNP and luciferase modRNA. Radioactivity was detected
in most tissues from the first time point (0.25 h), and results showed
that the injection site and the liver were the major sites of
distribution, with maximum concentrations observed at 8–48 h post-dose [26].
Furthermore, in animals that received the BNT162b2 injection,
reversible hepatic effects were observed, including enlarged liver,
vacuolation, increased gamma glutamyl transferase (γGT) levels, and
increased levels of aspartate transaminase (AST) and alkaline
phosphatase (ALP) [26]. Transient hepatic effects induced by LNP delivery systems have been reported previously [27,28,29,30],
nevertheless, it has also been shown that the empty LNP without modRNA
alone does not introduce any significant liver injury [27].
Therefore, in this study, we aim to examine the effect of BNT162b2 on a
human liver cell line in vitro and investigate if BNT162b2 can be
reverse transcribed into DNA through endogenous mechanisms.
2. Materials and Methods
2.1. Cell Culture
Huh7 cells (JCRB Cell Bank, Osaka, Japan) were cultured in 37 °C at 5% CO2 with DMEM medium (HyClone, HYCLSH30243.01) supplemented with 10% (v/v) fetal bovine serum (Sigma-Aldrich, F7524-500ML, Burlington, MA, USA) and 1% (v/v)
Penicillin-Streptomycin (HyClone, SV30010, Logan, UT, USA). For
BNT162b2 treatment, Huh7 cells were seeded with a density of 200,000
cells/well in 24-well plates. BNT162b2 mRNA vaccine (Pfizer BioNTech,
New York, NY, USA) was diluted with sterile 0.9% sodium chloride
injection, USP into a final concentration of 100 μg/mL as described in
the manufacturer’s guideline [31].
BNT162b2 suspension was then added in cell culture media to reach final
concentrations of 0.5, 1.0, or 2.0 μg/mL. Huh7 cells were incubated
with or without BNT162b2 for 6, 24, and 48 h. Cells were washed
thoroughly with PBS and harvested by trypsinization and stored in −80 °C
until further use.
2.2. REAL-TIME RT-QPCR
RNA
from the cells was extracted with RNeasy Plus Mini Kit (Qiagen, 74134,
Hilden, Germany) following the manufacturer’s protocol. RT-PCR was
performed using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher
Scientific, K1622, Waltham, MA, USA) following the manufacturers
protocol. Real-time qPCR was performed using Maxima SYBR Green/ROX qPCR
Master Mix (Thermo Fisher Scientific, K0222, Waltham, MA, USA) with
primers for BNT162b2, LINE-1 and housekeeping genes ACTB and GAPDH (Table 1).
Table 1.
Primer sequences of RT-qPCR and PCR.
Table 1.
Primer sequences of RT-qPCR and PCR.
Target
Sequence
ACTB forward
CCTCGCCTTTGCCGATCC
ACTB reverse
GGATCTTCATGAGGTAGTCAGTC
GAPDH forward
CTCTGCTCCTCCTGTTCGAC
GAPDH reverse
TTAAAAGCAGCCCTGGTGAC
LINE-1 forward
TAACCAATACAGAGAAGTGC
LINE-1 reverse
GATAATATCCTGCAGAGTGT
BNT162b2 forward
CGAGGTGGCCAAGAATCTGA
BNT162b2 reverse
TAGGCTAAGCGTTTTGAGCTG
2.3. Immunofluorescence Staining and Confocal Imaging
Huh7
cells were cultured in eight-chamber slides (LAB-TEK, 154534, Santa
Cruz, CA, USA) with a density of 40,000 cells/well, with or without
BNT162b2 (0.5, 1 or 2 µg/mL) for 6 h. Immunohistochemistry was performed
using primary antibody anti-LINE-1 ORF1p mouse monoclonal antibody
(Merck, 3574308, Kenilworth, NJ, USA), secondary antibody Cy3 Donkey
anti-mouse (Jackson ImmunoResearch, West Grove, PA, USA), and Hoechst
(Life technologies, 34850, Carlsbad, CA, USA), following the protocol
from Thermo Fisher (Waltham, MA, USA). Two images per condition were
taken using a Zeiss LSM 800 and a 63X oil immersion objective, and the
staining intensity was quantified on the individual whole cell area and
the nucleus area on 15 cells per image by ImageJ 1.53c. LINE-1 staining
intensity for the cytosol was calculated by subtracting the intensity of
the nucleus from that of the whole cell. All images of the cells were
assigned a random number to prevent bias. To mark the nuclei (determined
by the Hoechst staining) and the whole cells (determined by the borders
of the LINE-1 fluorescence), the Freehand selection tool was used.
These areas were then measured, and the mean intensity was used to
compare the groups.
2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and Sanger Sequencing
Genomic
DNA was extracted from cell pellets with PBND buffer (10 mM Tris-HCl pH
8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20) according to
protocol described previously [32].
To remove residual RNA from the DNA preparation, RNase (100 µg/mL,
Qiagen, Hilden, Germany) was added to the DNA preparation and incubated
at 37 °C for 3 h, followed by 5 min at 95 °C. PCR was then performed
using primers targeting BNT162b2 (sequences are shown in Table 1),
with the following program: 5 min at 95 °C, 35 cycles of 95 °C for 30
s, 58 °C for 30 s, and 72 °C for 1 min; finally, 72 °C for 5 min and 12
°C for 5 min. PCR products were run on 1.4% (w/v)
agarose gel. Bands corresponding to the amplicons of the expected size
(444 bps) were cut out and DNA was extracted using QIAquick PCR
Purification Kit (Qiagen, 28104, Hilden, Germany), following the
manufacturer’s instructions. The sequence of the DNA amplicon was
verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany).
Statistics
Statistical comparisons were performed using two-tailed Student’s t-test and ANOVA. Data are expressed as the mean ± SEM or ± SD. Differences with p < 0.05 are considered significant.
2.5. Ethical Statements
The Huh7 cell line was obtained from Japanese Collection of Research Bioresources (JCRB) Cell Bank.
3. Results
3.1. BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency
To
determine if BNT162b2 enters human liver cells, we exposed human liver
cell line Huh7 to BNT162b2. In a previous study on the uptake kinetics
of LNP delivery in Huh7 cells, the maximum biological efficacy of LNP
was observed between 4–7 h [33].
Therefore, in our study, Huh7 cells were cultured with or without
increasing concentrations of BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6,
24, and 48 h. RNA was extracted from cells and a real-time quantitative
reverse transcription polymerase chain reaction (RT-qPCR) was performed
using primers targeting the BNT162b2 sequence, as illustrated in Figure 1. The full sequence of BNT162b2 is publicly available [34]
and contains a two-nucleotides cap; 5′- untranslated region (UTR) that
incorporates the 5′ -UTR of a human α-globin gene; the full-length of
SARS-CoV-2 S protein with two proline mutations; 3′-UTR that
incorporates the human mitochondrial 12S rRNA (mtRNR1) segment and human
AES/TLE5 gene segment with two C→U mutations; poly(A) tail. Detailed
analysis of the S protein sequence in BNT162b2 revealed 124 sequences
that are 100% identical to human genomic sequences and three sequences
with only one nucleotide (nt) mismatch in 19–26 nts (Table S1, see Supplementary Materials).
To detect BNT162b2 RNA level, we designed primers with forward primer
located in SARS-CoV-2 S protein regions and reverse primer in 3′-UTR,
which allows detection of PCR amplicon unique to BNT162b2 without
unspecific binding of the primers to human genomic regions.
Figure 1.
PCR primer set used to detect mRNA level and reverse-transcription of
BNT162b2. Illustration of BNT162b2 was adapted from previously described
literature [34].
RT-qPCR results showed that Huh7 cells treated
with BNT162b2 had high levels of BNT162b2 mRNA relative to housekeeping
genes at 6, 24, and 48 h (Figure 2, presented in logged 2−ΔΔCT
due to exceptionally high levels). The three BNT162b2 concentrations
led to similar intracellular BNT162b2 mRNA levels at the different time
points, except that the significant difference between 1.0 and 2.0 µg/mL
was observed at 48 h. BNT162b2 mRNA levels were significantly decreased
at 24 h compared to 6 h, but increased again at 48 h.
Figure 2.
BNT162b2 mRNA levels in Huh7 cells treated with BNT162b2. Huh7 cells
were treated without (Ctrl) or with 0.5 (V1), 1 (V2), and 2 µg/mL (V3)
of BNT162b2 for 6 (green dots), 24 (orange dots), and 48 h (blue dots).
RNA was purified and qPCR was performed using primers targeting
BNT162b2. RNA levels of BNT162b2 are presented as logged 2−ΔΔCT values relative to house-keeping genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated).
3.2. Effect of BNT162b2 on Human Endogenous Reverse Transcriptase Long Interspersed Nuclear Element-1 (LINE-1)
Here we examined the effect of BNT162b2 on LINE-1
gene expression. RT-qPCR was performed on RNA purified from Huh7 cells
treated with BNT162b2 (0, 0.5, 1.0, and 2.0 µg/mL) for 6, 24, and 48 h,
using primers targeting LINE-1. Significantly increased LINE-1 expression compared to control was observed at 6 h by 2.0 µg/mL BNT162b2, while lower BNT162b2 concentrations decreased LINE-1 expression at all time points (Figure 3).
Figure 3. LINE-1 mRNA levels in Huh7 cells
treated with BNT162b2. Huh7 cells were treated without (Ctrl) or with
0.5 (V1), 1 (V2), and 2 µg/mL (V3) of BNT162b2 for 6 (green dots), 24
(red dots), and 48 h (blue dots). RNA was purified and qPCR was
performed using primers targeting LINE-1. RNA levels of LINE-1 are presented as 2−ΔΔCT values relative to house-keeping genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated; † p < 0.05 vs. 6 h-Ctrl).
Next, we studied the effect of BNT162b2 on
LINE-1 protein level. The full-length LINE-1 consists of a 5′
untranslated region (UTR), two open reading frames (ORFs), ORF1 and
ORF2, and a 3′UTR, of which ORF1 is an RNA binding protein with
chaperone activity. The retrotransposition activity of LINE-1 has been
demonstrated to involve ORF1 translocation to the nucleus [35].
Huh7 cells treated with or without BNT162b2 (0.5, 1.0 and 2.0 µg/mL)
for 6 h were fixed and stained with antibodies binding to LINE-1 ORF1p,
and DNA-specific probe Hoechst for visualization of cell nucleus (Figure 4a).
Quantification of immunofluorescence staining intensity showed that
BNT162b2 increased LINE-1 ORF1p protein levels in both the whole cell
area and nucleus at all concentrations tested (Figure 4b–d).
Figure 4.
Immunohistochemistry of Huh7 cells treated with BNT162b2 on LINE-1
protein distribution. Huh7 cells were treated without (Ctrl) or with
0.5, 1, and 2 µg/mL of BNT162b2 for 6 h. Cells were fixed and stained
with antibodies binding to LINE-1 ORF1p (red) and DNA-specific probe
Hoechst for visualization of cell nucleus (blue). (a) Representative images of LINE-1 expression in Huh7 cells treated with or without BNT162b2. (b–d) Quantification of LINE-1 protein in whole cell area (b), cytosol (c), and nucleus (d).
All data were analyzed using One-Way ANOVA, and graphs were created
using GraphPad Prism V 9.2. All data is presented as mean ± SD (** p < 0.01; *** p < 0.001; **** p < 0.0001 as indicated).
3.3. Detection of Reverse Transcribed BNT162b2 DNA in Huh7 Cells
A previous study has shown that entry of LINE-1 protein into the nucleus is associated with retrotransposition [35].
In the immunofluorescence staining experiment described above,
increased levels of LINE-1 in the nucleus were observed already at the
lowest concentration of BNT162b2 (0.5 µg/mL). To examine if BNT162b2 is
reversely transcribed into DNA when LINE-1 is elevated, we purified
genomic DNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2 for 6,
24, and 48 h. Purified DNA was treated with RNase to remove RNA and
subjected to PCR using primers targeting BNT162b2, as illustrated in Figure 1. Amplified DNA fragments were then visualized by electrophoresis and gel-purified (Figure 5).
BNT162b2 DNA amplicons were detected in all three time points (6, 24,
and 48 h). Sanger sequencing confirmed that the DNA amplicons were
identical to the BNT162b2 sequence flanked by the primers (Table 2).
To ensure that the DNA amplicons were derived from DNA but not BNT162b2
RNA, we also performed PCR on RNA purified from Huh7 cells treated with
0.5 µg/mL BNT162b2 for 6 h, with or without RNase treatment (Ctrl 5 and
6 in Figure 5), and no amplicon was detected in the RNA samples subjected to PCR.
Figure 5.
Detection of DNA amplicons of BNT162b2 in Huh7 cells treated with
BNT162b2. Huh7 cells were treated without (Ctrl) or with 0.5 µg/mL of
BNT162b2 for 6, 24, and 48 h. Genomic DNA was purified and digested with
100 µg/mL RNase. PCR was run on all samples with primers targeting
BNT162b2, as shown in Figure 1 and Table 1.
DNA amplicons (444 bps) were visualized on agarose gel. BNT: BNT162b2;
L: DNA ladder; Ctrl1: cultured Huh7 cells; Ctrl2: Huh7 cells without
BNT162b2 treatment collected at 6 h; Ctrl3: Huh7 cells without BNT162b2
treatment collected at 24 h; Ctrl4: Huh7 cells without BNT162b2
treatment collected at 48 h; Ctrl5: RNA from Huh7 cells treated with 0.5
µg/mL of BNT162b2 for 6 h; Ctrl6: RNA from Huh7 cells treated with 0.5
µg/mL of BNT162b2 for 6 h, digested with RNase.
Table 2.
Sanger sequencing result of the BNT162b2 amplicon.
Table 2.
Sanger sequencing result of the BNT162b2 amplicon.
In
this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is
able to enter the human liver cell line Huh7 in vitro. BNT162b2 mRNA is
reverse transcribed intracellularly into DNA as fast as 6 h after
BNT162b2 exposure. A possible mechanism for reverse transcription is
through endogenous reverse transcriptase LINE-1, and the nucleus protein
distribution of LINE-1 is elevated by BNT162b2.
Intracellular accumulation of LNP in hepatocytes has been demonstrated in vivo [36].
A preclinical study on BNT162b2 showed that BNT162b2 enters the human
cell line HEK293T cells and leads to robust expression of BNT162b2
antigen [37].
Therefore, in this study, we first investigated the entry of BNT162b2
in the human liver cell line Huh7 cells. The choice of BNT162b2
concentrations used in this study warrants explanation. BNT162b2 is
administered as a series of two doses three weeks apart, and each dose
contains 30 µg of BNT162b2 in a volume of 0.3 mL, which makes the local
concentration at the injection site at the highest 100 µg/mL [31].
A previous study on mRNA vaccines against H10N8 and H7N9 influenza
viruses using a similar LNP delivery system showed that the mRNA vaccine
can distribute rather nonspecifically to several organs such as liver,
spleen, heart, kidney, lung, and brain, and the concentration in the
liver is roughly 100 times lower than that of the intra-muscular
injection site [38].
In the assessment report on BNT162b2 provided to EMA by Pfizer, the
pharmacokinetic distribution studies in rats demonstrated that a
relatively large proportion (up to 18%) of the total dose distributes to
the liver [26].
We therefore chose to use 0.5, 1, and 2 μg/mL of vaccine in our
experiments on the liver cells. However, the effect of a broader range
of lower and higher concentrations of BNT162b2 should also be verified
in future studies.
In the current study, we
employed a human liver cell line for in vitro investigation. It is worth
investigating if the liver cells also present the vaccine-derived
SARS-CoV-2 spike protein, which could potentially make the liver cells
targets for previously primed spike protein reactive cytotoxic T cells.
There has been case reports on individuals who developed autoimmune
hepatitis [39]
after BNT162b2 vaccination. To obtain better understanding of the
potential effects of BNT162b2 on liver function, in vivo models are
desired for future studies.
In the BNT162b2 toxicity report, no genotoxicity nor carcinogenicity studies have been provided [26].
Our study shows that BNT162b2 can be reverse transcribed to DNA in
liver cell line Huh7, and this may give rise to the concern if
BNT162b2-derived DNA may be integrated into the host genome and affect
the integrity of genomic DNA, which may potentially mediate genotoxic
side effects. At this stage, we do not know if DNA reverse transcribed
from BNT162b2 is integrated into the cell genome. Further studies are
needed to demonstrate the effect of BNT162b2 on genomic integrity,
including whole genome sequencing of cells exposed to BNT162b2, as well
as tissues from human subjects who received BNT162b2 vaccination.
Human
autonomous retrotransposon LINE-1 is a cellular endogenous reverse
transcriptase and the only remaining active transposon in humans, able
to retrotranspose itself and other nonautonomous elements [40,41], and ~17% of the human genome are comprised of LINE-1 sequences [42]. The nonautonomous Alu
elements, short, interspersed nucleotide elements (SINEs),
variable-number-of-tandem-repeats (VNTR), as well as cellular
mRNA-processed pseudogenes, are retrotransposed by the LINE-1
retrotransposition proteins working in trans [43,44].
A recent study showed that endogenous LINE-1 mediates reverse
transcription and integration of SARS-CoV-2 sequences in the genomes of
infected human cells [25]. Furthermore, expression of endogenous LINE-1 is often increased upon viral infection, including SARS-CoV-2 infection [45,46,47]. Previous studies showed that LINE-1 retrotransposition activity is regulated by RNA metabolism [48,49], DNA damage response [50], and autophagy [51]. Efficient retrotransposition of LINE-1 is often associated with cell cycle and nuclear envelope breakdown during mitosis [52,53], as well as exogenous retroviruses [54,55],
which promotes entrance of LINE-1 into the nucleus. In our study, we
observed increased LINE-1 ORF1p distribution as determined by
immunohistochemistry in the nucleus by BNT162b2 at all concentrations
tested (0.5, 1, and 2 μg/mL), while elevated LINE-1
gene expression was detected at the highest BNT162b2 concentration (2
μg/mL). It is worth noting that gene transcription is regulated by
chromatin modifications, transcription factor regulation, and the rate
of RNA degradation, while translational regulation of protein involves
ribosome recruitment on the initiation codon, modulation of peptide
elongation, termination of protein synthesis, or ribosome biogenesis.
These two processes are controlled by different mechanisms, and
therefore they may not always show the same change patterns in response
to external challenges. The exact regulation of LINE-1 activity in
response to BNT162b2 merits further study.
The
cell model that we used in this study is a carcinoma cell line, with
active DNA replication which differs from non-dividing somatic cells. It
has also been shown that Huh7 cells display significant different gene
and protein expression including upregulated proteins involved in RNA
metabolism [56].
However, cell proliferation is also active in several human tissues
such as the bone marrow or basal layers of epithelia as well as during
embryogenesis, and it is therefore necessary to examine the effect of
BNT162b2 on genomic integrity under such conditions. Furthermore,
effective retrotransposition of LINE-1 has also been reported in
non-dividing and terminally differentiated cells, such as human neurons [57,58].
The
Pfizer EMA assessment report also showed that BNT162b2 distributes in
the spleen (<1.1%), adrenal glands (<0.1%), as well as low and
measurable radioactivity in the ovaries and testes (<0.1%) [26].
Furthermore, no data on placental transfer of BNT162b2 is available
from Pfizer EMA assessment report. Our results showed that BNT162b2 mRNA
readily enters Huh7 cells at a concentration (0.5 µg/mL) corresponding
to 0.5% of the local injection site concentration, induce changes in
LINE-1 gene and protein expression, and within 6 h, reverse
transcription of BNT162b2 can be detected. It is therefore important to
investigate further the effect of BNT162b2 on other cell types and
tissues both in vitro and in vivo.
5. Conclusions
Our
study is the first in vitro study on the effect of COVID-19 mRNA
vaccine BNT162b2 on human liver cell line. We present evidence on fast
entry of BNT162b2 into the cells and subsequent intracellular reverse
transcription of BNT162b2 mRNA into DNA.
M.A.,
F.O.F., D.Y., M.B. and C.L. performed in vitro experiments. M.A. and
F.O.F. performed data analysis. M.R. and Y.D.M. contributed to the
implementation of the research, designed, and supervised the study.
Y.D.M. wrote the paper with input from all authors. All authors have
read and agreed to the published version of the manuscript.
Funding
This
study was supported by the Swedish Research Council (SRC), Strategic Research
Area Exodiab, Dnr 2009-1039, the Swedish Government Fund for Clinical
Research (ALF) and the foundation of Skåne University Hospital.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All data supporting the findings of this study are available within the article and supporting information.
Acknowledgments
The
authors thank Sven Haidl, Maria Josephson, Enming Zhang, Jia-Yi Li,
Caroline Haikal, and Pradeep Bompada for their support to this study.
Conflicts of Interest
The authors declare no conflict of interest.
References
World Health Organization. Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on 22 February 2022).
Mulligan,
M.J.; Lyke, K.E.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.;
Neuzil, K.; Raabe, V.; Bailey, R.; Swanson, K.A.; et al. Phase I/II
study of COVID-19 RNA vaccine BNT162b1 in adults. Nature2020, 586, 589–593. [Google Scholar] [CrossRef] [PubMed]
Walsh,
E.E.; Frenck, R.W., Jr.; Falsey, A.R.; Kitchin, N.; Absalon, J.;
Gurtman, A.; Lockhart, S.; Neuzil, K.; Mulligan, M.J.; Bailey, R.; et
al. Safety and Immunogenicity of Two RNA-Based COVID-19 Vaccine
Candidates. N. Engl. J. Med.2020, 383, 2439–2450. [Google Scholar] [CrossRef] [PubMed]
Polack,
F.P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart,
S.; Perez, J.L.; Perez Marc, G.; Moreira, E.D.; Zerbini, C.; et al.
Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine. N. Engl. J. Med.2020, 383, 2603–2615. [Google Scholar] [CrossRef] [PubMed]
Harris,
R.J.; Hall, J.A.; Zaidi, A.; Andrews, N.J.; Dunbar, J.K.; Dabrera, G.
Effect of Vaccination on Household Transmission of SARS-CoV-2 in
England. N. Engl. J. Med.2021, 385, 759–760. [Google Scholar] [CrossRef]
Butt,
A.A.; Omer, S.B.; Yan, P.; Shaikh, O.S.; Mayr, F.B. SARS-CoV-2 Vaccine
Effectiveness in a High-Risk National Population in a Real-World
Setting. Ann. Intern. Med.2021, 174, 1404–1408. [Google Scholar] [CrossRef]
Dagan,
N.; Barda, N.; Kepten, E.; Miron, O.; Perchik, S.; Katz, M.A.; Hernan,
M.A.; Lipsitch, M.; Reis, B.; Balicer, R.D. BNT162b2 mRNA Covid-19
Vaccine in a Nationwide Mass Vaccination Setting. N. Engl. J. Med.2021, 384, 1412–1423. [Google Scholar] [CrossRef]
Rossman,
H.; Shilo, S.; Meir, T.; Gorfine, M.; Shalit, U.; Segal, E. COVID-19
dynamics after a national immunization program in Israel. Nat. Med.2021, 27, 1055–1061. [Google Scholar] [CrossRef]
Fan,
B.E.; Shen, J.Y.; Lim, X.R.; Tu, T.M.; Chang, C.C.R.; Khin, H.S.W.;
Koh, J.S.; Rao, J.P.; Lau, S.L.; Tan, G.B.; et al. Cerebral venous
thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: A black swan
event. Am. J. Hematol.2021, 96, E357–E361. [Google Scholar] [CrossRef]
Menni,
C.; Klaser, K.; May, A.; Polidori, L.; Capdevila, J.; Louca, P.; Sudre,
C.H.; Nguyen, L.H.; Drew, D.A.; Merino, J.; et al. Vaccine side-effects
and SARS-CoV-2 infection after vaccination in users of the COVID
Symptom Study app in the UK: A prospective observational study. Lancet Infect. Dis.2021, 21, 939–949. [Google Scholar] [CrossRef]
Hansen,
T.; Titze, U.; Kulamadayil-Heidenreich, N.S.A.; Glombitza, S.; Tebbe,
J.J.; Rocken, C.; Schulz, B.; Weise, M.; Wilkens, L. First case of
postmortem study in a patient vaccinated against SARS-CoV-2. Int. J. Infect. Dis.2021, 107, 172–175. [Google Scholar] [CrossRef] [PubMed]
Kadali,
R.A.K.; Janagama, R.; Peruru, S.; Malayala, S.V. Side effects of
BNT162b2 mRNA COVID-19 vaccine: A randomized, cross-sectional study with
detailed self-reported symptoms from healthcare workers. Int. J. Infect. Dis.2021, 106, 376–381. [Google Scholar] [CrossRef] [PubMed]
Parkash, O.; Sharko, A.; Farooqi, A.; Ying, G.W.; Sura, P. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine. Cureus2021, 13, e14741. [Google Scholar] [CrossRef] [PubMed]
Mazzatenta,
C.; Piccolo, V.; Pace, G.; Romano, I.; Argenziano, G.; Bassi, A.
Purpuric lesions on the eyelids developed after BNT162b2 mRNA COVID-19
vaccine: Another piece of SARS-CoV-2 skin puzzle? J. Eur. Acad. Dermatol. Venereol.2021, 35, e543–e545. [Google Scholar] [CrossRef]
Lee,
E.J.; Cines, D.B.; Gernsheimer, T.; Kessler, C.; Michel, M.; Tarantino,
M.D.; Semple, J.W.; Arnold, D.M.; Godeau, B.; Lambert, M.P.; et al.
Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol.2021, 96, 534–537. [Google Scholar] [CrossRef]
Das,
B.B.; Kohli, U.; Ramachandran, P.; Nguyen, H.H.; Greil, G.; Hussain,
T.; Tandon, A.; Kane, C.; Avula, S.; Duru, C.; et al. Myopericarditis
following mRNA COVID-19 Vaccination in Adolescents 12 through 18 Years
of Age. J. Pediatr.2021, 238, 26–32.e1. [Google Scholar] [CrossRef]
McLaurin-Jiang,
S.; Garner, C.D.; Krutsch, K.; Hale, T.W. Maternal and Child Symptoms
Following COVID-19 Vaccination Among Breastfeeding Mothers. Breastfeed. Med.2021, 16, 702–709. [Google Scholar] [CrossRef]
Barda,
N.; Dagan, N.; Ben-Shlomo, Y.; Kepten, E.; Waxman, J.; Ohana, R.;
Hernan, M.A.; Lipsitch, M.; Kohane, I.; Netzer, D.; et al. Safety of the
BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Setting. N. Engl. J. Med.2021, 385, 1078–1090. [Google Scholar] [CrossRef]
Baden,
L.R.; El Sahly, H.M.; Essink, B.; Kotloff, K.; Frey, S.; Novak, R.;
Diemert, D.; Spector, S.A.; Rouphael, N.; Creech, C.B.; et al. Efficacy
and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med.2021, 384, 403–416. [Google Scholar] [CrossRef]
Sadoff,
J.; Gray, G.; Vandebosch, A.; Cardenas, V.; Shukarev, G.; Grinsztejn,
B.; Goepfert, P.A.; Truyers, C.; Fennema, H.; Spiessens, B.; et al.
Safety and Efficacy of Single-Dose Ad26.COV2.S Vaccine against Covid-19. N. Engl. J. Med.2021, 384, 2187–2201. [Google Scholar] [CrossRef] [PubMed]
Eichinger, S.; Warkentin, T.E.; Greinacher, A. Thrombotic Thrombocytopenia after ChAdOx1 nCoV-19 Vaccination. Reply. N. Engl. J. Med.2021, 385, e11. [Google Scholar] [CrossRef] [PubMed]
Doroftei,
B.; Ciobica, A.; Ilie, O.D.; Maftei, R.; Ilea, C. Mini-Review
Discussing the Reliability and Efficiency of COVID-19 Vaccines. Diagnostics2021, 11, 579. [Google Scholar] [CrossRef]
Zhang,
L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch,
R. Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of
cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA2021, 118, e2105968118. [Google Scholar] [CrossRef] [PubMed]
Tanaka,
H.; Takata, N.; Sakurai, Y.; Yoshida, T.; Inoue, T.; Tamagawa, S.;
Nakai, Y.; Tange, K.; Yoshioka, H.; Maeki, M.; et al. Delivery of
Oligonucleotides Using a Self-Degradable Lipid-Like Material. Pharmaceutics2021, 13, 544. [Google Scholar] [CrossRef]
Sedic,
M.; Senn, J.J.; Lynn, A.; Laska, M.; Smith, M.; Platz, S.J.; Bolen, J.;
Hoge, S.; Bulychev, A.; Jacquinet, E.; et al. Safety Evaluation of
Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat
and Cynomolgus Monkey. Vet. Pathol.2018, 55, 341–354. [Google Scholar] [CrossRef]
Sato,
Y.; Matsui, H.; Yamamoto, N.; Sato, R.; Munakata, T.; Kohara, M.;
Harashima, H. Highly specific delivery of siRNA to hepatocytes
circumvents endothelial cell-mediated lipid nanoparticle-associated
toxicity leading to the safe and efficacious decrease in the hepatitis B
virus. J. Control. Release2017, 266, 216–225. [Google Scholar] [CrossRef]
Gallud,
A.; Munson, M.J.; Liu, K.; Idstrom, A.; Barriga, H.M.; Tabaei, S.;
Aliakbarinodehi, N.; Ojansivu, M.; Lubart, Q.; Doutch, J.J.; et al. Time
evolution of PEG-shedding and serum protein coronation determines the
cell uptake kinetics and delivery of lipid nanoparticle. bioRxiv2021. [Google Scholar] [CrossRef]
Mita,
P.; Wudzinska, A.; Sun, X.; Andrade, J.; Nayak, S.; Kahler, D.J.;
Badri, S.; LaCava, J.; Ueberheide, B.; Yun, C.Y.; et al. LINE-1 protein
localization and functional dynamics during the cell cycle. Elife2018, 7, e30058. [Google Scholar] [CrossRef]
Sato,
Y.; Kinami, Y.; Hashiba, K.; Harashima, H. Different kinetics for the
hepatic uptake of lipid nanoparticles between the apolipoprotein E/low
density lipoprotein receptor and the
N-acetyl-d-galactosamine/asialoglycoprotein receptor pathway. J. Control. Release2020, 322, 217–226. [Google Scholar] [CrossRef]
Vogel,
A.B.; Kanevsky, I.; Che, Y.; Swanson, K.A.; Muik, A.; Vormehr, M.;
Kranz, L.M.; Walzer, K.C.; Hein, S.; Guler, A.; et al. BNT162b vaccines
protect rhesus macaques from SARS-CoV-2. Nature2021, 592, 283–289. [Google Scholar] [CrossRef] [PubMed]
Bahl,
K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.;
Laska, M.E.; Smith, M.; Almarsson, O.; Thompson, J.; et al. Preclinical
and Clinical Demonstration of Immunogenicity by mRNA Vaccines against
H10N8 and H7N9 Influenza Viruses. Mol. Ther.2017, 25, 1316–1327. [Google Scholar] [CrossRef] [PubMed]
Bril,
F.; Al Diffalha, S.; Dean, M.; Fettig, D.M. Autoimmune hepatitis
developing after coronavirus disease 2019 (COVID-19) vaccine: Causality
or casualty? J. Hepatol.2021, 75, 222–224. [Google Scholar] [CrossRef]
Kazazian, H.H., Jr.; Moran, J.V. Mobile DNA in Health and Disease. N. Engl. J. Med.2017, 377, 361–370. [Google Scholar] [CrossRef] [PubMed]
Coffin, J.M.; Fan, H. The Discovery of Reverse Transcriptase. Annu. Rev. Virol.2016, 3, 29–51. [Google Scholar] [CrossRef]
Lander,
E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.;
Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al. Initial sequencing
and analysis of the human genome. Nature2001, 409, 860–921. [Google Scholar] [CrossRef]
Ostertag,
E.M.; Goodier, J.L.; Zhang, Y.; Kazazian, H.H., Jr. SVA elements are
nonautonomous retrotransposons that cause disease in humans. Am. J. Hum. Genet.2003, 73, 1444–1451. [Google Scholar] [CrossRef]
Hancks, D.C.; Kazazian, H.H., Jr. Active human retrotransposons: Variation and disease. Curr. Opin. Genet. Dev.2012, 22, 191–203. [Google Scholar] [CrossRef]
Jones,
R.B.; Song, H.; Xu, Y.; Garrison, K.E.; Buzdin, A.A.; Anwar, N.;
Hunter, D.V.; Mujib, S.; Mihajlovic, V.; Martin, E.; et al. LINE-1
retrotransposable element DNA accumulates in HIV-1-infected cells. J. Virol.2013, 87, 13307–13320. [Google Scholar] [CrossRef]
Macchietto,
M.G.; Langlois, R.A.; Shen, S.S. Virus-induced transposable element
expression up-regulation in human and mouse host cells. Life Sci. Alliance2020, 3, e201900536. [Google Scholar] [CrossRef] [PubMed]
Yin, Y.; Liu, X.Z.; He, X.; Zhou, L.Q. Exogenous Coronavirus Interacts With Endogenous Retrotransposon in Human Cells. Front. Cell Infect. Microbiol.2021, 11, 609160. [Google Scholar] [CrossRef] [PubMed]
Belancio, V.P.; Roy-Engel, A.M.; Deininger, P. The impact of multiple splice sites in human L1 elements. Gene2008, 411, 38–45. [Google Scholar] [CrossRef] [PubMed]
Dai,
L.; Taylor, M.S.; O’Donnell, K.A.; Boeke, J.D. Poly(A) binding protein
C1 is essential for efficient L1 retrotransposition and affects L1 RNP
formation. Mol. Cell Biol.2012, 32, 4323–4336. [Google Scholar] [CrossRef]
Suzuki, Y.; Craigie, R. The road to chromatin—Nuclear entry of retroviruses. Nat. Rev. Microbiol.2007, 5, 187–196. [Google Scholar] [CrossRef]
Shi,
J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein
expression between human livers and the hepatic cell lines HepG2, Hep3B,
and Huh7 using SWATH and MRM-HR proteomics: Focusing on
drug-metabolizing enzymes. Drug Metab. Pharmacokinet.2018, 33, 133–140. [Google Scholar] [CrossRef] [PubMed]
Kubo,
S.; Seleme, M.C.; Soifer, H.S.; Perez, J.L.; Moran, J.V.; Kazazian,
H.H., Jr.; Kasahara, N. L1 retrotransposition in nondividing and primary
human somatic cells. Proc. Natl. Acad. Sci. USA2006, 103, 8036–8041. [Google Scholar] [CrossRef] [PubMed]
Macia,
A.; Widmann, T.J.; Heras, S.R.; Ayllon, V.; Sanchez, L.;
Benkaddour-Boumzaouad, M.; Munoz-Lopez, M.; Rubio, A.; Amador-Cubero,
S.; Blanco-Jimenez, E.; et al. Engineered LINE-1 retrotransposition in
nondividing human neurons. Genome Res.2017, 27, 335–348. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Meer over het farmaceutische maffia lid Pfizer: ‘Pfizer CEO: Israëliërs zijn proefkonijn voor testen van vaccin‘ (!!!!) De CEO van Pfizer die zonder blikken of blozen aangeeft waar het om gaat als men gevaccineerd is……. Israël
waar intussen velen al spijt hebben zich te hebben laten
vaccineren….. Intussen heeft Pfizer afgezien van een contract met
India, daar het land extra garanties wilde over de veiligheid en daar
zag Pfizer geen brood in…… India een land met een bevolking van 1,3
miljard mensen, ofwel daar was genoeg winst te behalen voor Pfizer; moet
je nagaan….. Er is nog een groot land dat extra veiligheid eiste,
waarop Pfizer ook de stekker uit die onderhandelingen trok….. Als je
hier naar zoekt op het net, maakt niet uit op wat voor manier, vind je
hier niets over terug, tekenend……..
‘Pfizer Coronavirus vaccin: wat je niet wordt verteld over de vaccins tegen COVID-19‘
In augustus 2020 deed Pfizer CEO Bourla 62% van z’n aandelen Pfizer van
de hand, blijkbaar heeft hij er geen vertrouwen in dat de beloften van
overheden dat het bedrijf niet vervolgd zal worden voor ernstige
bijwerkingen ook zullen worden geëerbiedigd door rechters mocht men het
bedrijf aanklagen voor doden als gevolg van vaccinatie dan wel voor ernstige (chronische)
bijwerkingen……
‘Intrekken uitzendlicentie door Rusland voor Deutsche Welle ‘is een klap in het gezicht van het Duitse volk’‘
RT Deutsch dat werd platgelegd in Duitsland wordt o.a. verweten
complottheorieën over COVID te brengen, dit door het uitzenden van een
gesprek met een paar COVID-vaccinatieweigeraars……. (te zot voor
woorden!!) Oh, en Deutsche Welle is een Duitse staatsomroep die westerse
propaganda uitzond in Rusland, iets
waarover men niet lult in het westen en als men er al over spreeekt
wordt er onomwonden gezegd dat dit soort westerse platforms
onafhankelijk zijn….. ha! ha! ha! ha! ha! ha! ha!
‘COVID-19 vaccin zou het immuunsysteem aantasten…….‘ (!!!!)
Benieuwd ook of de vandaag (het is terwijl ik dit schrijf 11 januari 2022 /////) overleden
David Sassoli, voorzitter van het EU parlement, 3 dubbel gevaccineerd
was, daar ook hij een afwijking had aan het immuunsysteem……
‘Coronavirus: paniek over de Deltavariant is onterecht en zwaar overdreven‘ (!!!!)
En zie de links in dat bericht naar artikelen over de PCR test en de
bezuinigingen op de gezondheidszorg >> die bezuinigingen zijn de
reden voor de
Coronamaatregelen, die werden immers genomen daar er te weinig
ziekenhuisbedden, IC bedden en verpleegkundigen waren. Zoals ook in het bericht hierboven al gemeld: het aantal
verpleegkundigen is als de bedden sterk teruggelopen door wanbeleid van
de afbraakkabinetten Rutte 1, 2 en 3….. Zo waren er bij aantreden van
Rutte 1 nog 2.200 IC bedden, dat was bij aanvang van de Coronacrisis
teruggebracht naar 1.100 bedden….. Dus als je sterk bent
benadeeld door de Coronamaatregelen, weet je wie hiervoor
verantwoordelijk zijn!! Zie wat betreft dat bericht ook: ‘Coronavirus: artsen willen via rechtszaak tegen de staat COVID-19 van A-lijst krijgen, daar het een griepvirus zou zijn‘De video die oorspronkelijk in het artikel was te zien is
gecensureerd, tja je wilt natuurlijk niet dat de bevolking begrijpt
hoezeer men werd en wordt belazerd……
‘Coronabeslommeringen: ook na vaccinatie kan je het virus doorgeven, plus de zoveelste blunder van CDA minister de Jonge‘
Het na dit bericht gebrachte nieuws dat je niet besmettelijk bent na
vaccinatie, is achteraf gebeleken grote onzin te zijn en zou gebaseerd
zijn op een
foute interpretatie van een bericht uit de VS, lijkt me ook logisch daar
dr Fauci eerder al meldde dat gevaccineerden nog lang besmettelijk
blijven en zich aan de Coronamaatregelen dienen te houden, terwijl de
voormaligfe minister van Volksgezodnheid, CDA plork fde Jonge vorig jaar
zelf toegaf dat gevaccineerden niet veilig zijn…… (zie de
afbeelding met deze zwaar disfunctionerende kwezel in het blok met Pfizer links hierboven)
De denazificatie van Oekraïne, aangekondigd door de Russische president Putin, werd in het westen smalend afgedaan als propaganda om de militaire inval in dat land te legitimeren, ook het Witte Huis deed dit af als een belachelijke opmerking….. Terwijl het bekend is dat de VS Oekraïense neonazi bataljons heeft getraind, zelfs tot de inval van Rusland (ook Canadese wapeninstructeurs hebben zich hieraan schuldig gemaakt…..)…..
Voorts is het zeker dat de VS middels de CIA de staatsgreep tegen de democratische gekozen president Janoekovytsj heeft betaald (met 4 miljard dollar), de opstand die tot de staatsgreep leidde heeft georganiseerd en de uiteindelijke coup heeft georganiseerd en geregisseerd (waarbij men gebruikmaakte van neonazi-groeperingen), inclusief het betalen van huurmoordenaars die politieagenten en burgers doodschoten op het Maidanplein in Kiev (volgens sommigen waren deze moordenaars ook neonazi’s en dat zou me in het geheel niet verbazen).
Na de coup heeft de VS de corrupte neonazi Porosjenko aangesteld als ‘interim president’, vroeger noemden we dit beest bij de naam: juntaleider (dat ‘interim president’ moest de smerige lading >> een bloedige staatsgreep dan ook dekken en daarmee legitimeren…..)
De neonazi’s hebben daarna de illegale regering gecontroleerd en daarnaast kritische journalisten en politici belaagd dan wel zelfs vermoord….. Van vrije verkiezingen was en is geen sprake in Oekraïne, daar partijen zijn verboden die op grote steun kunnen rekenen van bijvoorbeeld mensen van Russische komaf….. Weet niet hoe jij hierover denkt, maar het uitsluiten van politieke partijen, geeft m.i. aan dat je met een dictatuur te maken hebt, zelfs met een fascistische dictatuur……
In het hierna weergegeven artikel van Mike Whitney, eerder gepubliceerd The Unz Review (ik nam het over van Information Clearing House), gaat deze verder in op het fascistische gehalte van Oekraïne en hoe de VS daar gebruik van heeft gemaakt en nog steeds maakt. Onder andere aandacht in dat artikel voor het feit dat het bureau van de Hoge Commissaris voor Mensenrechten (OHCHR) al in 2016 het neonazi-bataljon Azov, destijds al ‘bevorderd’ tot een officieel regiment van het Oekraïense leger, zich schuldig maakte aan oorlogsmisdaden als grootschalig plunderen, onwettige gijzeling en marteling (het noemen van moord op tegenstanders ging de OHCHR blijkbaar te ver, immers destijds had dit bataljon zicht al schuldig gemaakt aan het vermoorden van een groot aantal mensen…….)
Hier nog een paar ‘opmerkelijke zaken’ van de laatste paar dagen:
Gisteren vergistte een verslaggever van WDR 5 zich danig en week af van het platgetreden pad dat Rusland de door haar zelf ingestelde corridors onder vuur neemt, volgens deze figuur worden deze corridors onder vuur genomen, omdat Rusland ze niet afspreekt met de Oekraïense autoriteiten…… Kortom deze sufferd gaf toe dat het Oekraïense leger deze corridors onder vuur neemt!!
Men maakt zich in de reguliere westerse media en politiek druk over aanvallen van burgerdoelen door Rusland. Voor zover dat ook maar iets met de waarheid te maken heeft, immers neonazi-bataljons als Azov hebben er totaal geen moeite mee om de eigen burgers aan te vallen en de schuld daarvoor in de schoenen van Rusland te schuiven….. Wat betreft het aanvallen van burgerdoelen, melden westerse media NB keer op keer over burgers die hun appartementencomplexen veranderen in militaire aanvalsposten, dit door opgeworpen versperringen, het maken van tankvallen en versterkingen van die complexen om van daaruit Russen aan te kunnen vallen, dit zou volgens zeggen in alle Oekraïense steden het geval zijn…… Ofwel hoe kan je van een woonwijk een militair doel maken??!!!
Dan te bedenken dat men in de VS de stormloop op het Capitol van 6 januari 2021 toeschrijft aan nazi en ander tuig, terwijl het Witte Huis, het Pentagon en de CIA er geen moeite mee hebben om Oekraiense neonazi’s te trainen en te bewapenen als ze maar tegen Russen of mensen van Russische komaf vechten……. Hoe hypocriet en ziek wil je het hebben??
Hare kwaadaardigheid minister Kaag misbruikt de situatie in Oekraïne om te pleiten voor het inleveren van Nederlandse soevereiniteit ten gunste van de EU (ofwel van de grote EU staten Frankrijk, Duitsland, Polen e.a., echter waar de eerste 2 verreweg de belangrijkste zijn….)…. Vanmorgen hoorde ik in MAX Nieuwsweekend de potsierlijke kwast en meer dan waardeloze ‘politiek deskundige’ Kees Boonman* stellen dat het grootste deel van de Nederlanders achter het inleveren van soevereiniteit zou staan. ‘Iedereen zou dit wel begrijpen’ gezien de ‘Russische agressie’, aldus de fantast, die er geen moeite mee heeft als de VS weer eens een land naar god bombardeert….. Uiteraard heeft deze waardeloze sufferd geen begrip voor de positie van Rusland dat bijna het jaarrond agressieve NAVO oefeningen ziet langs haar westgrens en territoriale wateren (zelfs gericht op het binnenvallen van Russische grondgebied)…… Of wat dacht je van het zogenaamde VS raketschild in Polen en Roemenië, waarvan de VS de raketten in een mum van tijd kan veranderen in aanvalsraketten met al aanwezige meerdere kernkoppen, waarmee de VS grote Russische steden kan vernietigen en dat over afstanden die waren verboden in het INF-verdrag (niet voor niets ook dat de VS dit verdrag heeft opgezegd, zogenaamd vanwege een nieuwe generatie Russische kernraketten, die de VS op meerdere uitnodigingen van Rusland weigerde te inspecteren, inspecties zodat de VS kon zien dat deze raketten het INF-verdrag niet schenden >> ook al een zaak waarvoor de westerse politici en media geen aandacht hadden of hebben…..)
In
het WDR 5 nieuws van vanmiddag o.a. het bericht dat de Duitse
autoriteiten ongerust zijn over de aanvallen op mensen van Russische
komaf, aanvallen op hun winkels en zelfs de aanvallen waar kinderen van deze
mensen op school mee te maken hebben……. Ofwel dezelfde autoriteiten
hebben Rusland uit en te na gedemoniseerd, waarbij men de Russische
burgers heeft verweten niet tegen de Russische acties in Oekraïne te
hebben uitgesproken, ofwel dan moet je wel achter die acties staan en
ben je volgens deze autoriteiten blijkbaar vogelvrij verklaard…….
Lees het artikel van Whitney en geeft het ajb door, de hoogste tijd dat het westen stopt met haar vreselijke anti-Russische propaganda en dat deze wordt doorgeprikt, zonder dat de westerse politiek en reguliere media ook maar met één letter wijzen op de terechte angsten van Rusland en haar wil om Oekraïne te denazificeren…….. Het is in het westen al zo zot dat het neonazi-bataljon Azov openlijk mag worden geroemd, terwijl de ploerten van dat bataljon zich achter de nazi-Duitse aanval tegen Rusland hebben geschaard tijdens de Tweede Wereldoorlog (WOII) en de leden van dat bataljon zich bedienen van nazi-emblemen en geen moeite hebben met de Hitler groet…… Vergeet niet dat de strijd van Rusland tegen nazi-Duitsland aan 20 miljoen Russen het leven heeft gekost……
Je kan het volgende artikel vertalen met de vertaalapp van Information Clearing House, te vinden onder het volgende artikel, klik dan op ‘dutch’, of met deze vertaalapp,
die snel werkt en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt kan je kiezen voor Nederlands.
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
“I have spoken with
my Western colleagues about denazification.
They say:” What’s the problem? You also have
radical nationalists, don’t you?” Yes, we
do, but we don’t have them in our government
like Ukraine. And we don’t have thousands
of people marching in the streets with
torches and swastikas like Nazi Germany in
the 1930s? And we don’t praise the men who
killed Russians, Jews, and Poles during the
war. But in Ukraine, they do.” Vladimir Putin, Russian President
The United States has
been arming and training far-right militants
that are the ideological descendants of Nazi war
criminals that were directly involved in the
mass-extermination of Jews, Slavs and Gypsies
during the Second World War. These Ukrainian
storm troopers are among the most vicious and
malignant combatants Washington has ever
employed to implement its foreign policy agenda. Naturally, Washington sees these
fascist-zealots as mere pawns in its proxy war
on Russia. Even so, the ‘alliance of
convenience’ does not diminish the fact that
Uncle Sam is now in bed with right-wing
militants whose spiritual leader, Adolph Hitler,
was responsible for the deaths of tens of
millions of people as well as the destruction of
large parts of Europe and Russia. Check out this
clip from an article titled “Can Ukraine have a
‘Nazi problem’ with a Jewish president?:
“Ukraine really
does have a far-right problem, and it’s not
a fiction of Kremlin propaganda. And
it’s well past time to talk about it,”
explained journalist and expert on the
Ukrainian far right, Michael Colborne.
The most known
neo-Nazi group on Ukraine’s far right is the
Azov movement. The movement grew out of the
Azov Regiment (originally a Battalion),
formed in the chaos of war in early 2014.
It was formed by a
“ragtag group of far-right thugs, football
hooligans and international hangers-on,
including dozens of Russian citizens,” said
Colborne, who wrote a book on the
movement.”(“Can
Ukraine have a ‘Nazi problem’ with a Jewish
president?”, Jewish Unpacked)
While Russian President
Vladimir Putin is committed to removing
Ukraine’s Nazis from power, it is uncertain how
he will do so. Self-identified fascists now hold
positions of authority in the military, the
government and the Security Services. They have
also been the driving force behind the 8
year-long siege of the Donbass region in east
Ukraine that is mainly inhabited by ethnic
Russians. The militants’ hatred for their Slavic
brothers suggests that Hitler’s racial theories
are being ruthlessly applied in 21st Century
Europe. Here’s an excerpt from an article at The
Saker Blog:
“Since the
Western-backed coup in Kiev in 2014,
political organizations associated with
neo-Nazis infiltrated Ukrainian mainstream
politics as the Ukrainian government sent
troops to try to crush the Donbass uprisings
by force.
As Ukraine waged war
against breakaway forces in the Donetsk and
Lugansk People’s Republics, the Neo-Nazi
Groups in Ukraine gained notoriety for their
belligerent rhetoric towards the population
of the country’s east, as well as for
eagerly participating in the civil war….
The (Azov
Battalion’s) first commander was right-wing
nationalist Andriy Biletsky, who led the
paramilitary national socialist group called
“Patriot of Ukraine” and was the founder of
a neo-Nazi group, the Social-National
Assembly (SNA) in 2008. In 2010, Biletsky, a
former parliamentarian, apparently said that Ukraine was meant to “lead the white
races of the world in a final crusade …
against Semite-led Untermenschen (subhumans) ”by reports in a spate of Western
mainstream outlets.” (“Ukrainian
bad guys and a fair Russian response“,
Batko Milacic for the Saker Blog)
Readers should take a
minute to savor Washington’s duplicity on this
matter, after all, while the Biden
administration and the entire MSM was denouncing
the January 6 protestors as “racists” and “white
supremacists”, the US government was busy arming
and training “white crusader” Nazis to carry out
its war on Russia. What’s that all about? If
there was an Academy Award for hypocrisy, Uncle
Sam would be the hands-down favorite. Here’s
more from the same piece:
“Azov took part in
subsequent hostilities in Donbass and was
incorporated into the National Guard of
Ukraine in November 2014, although its
members continued to wear neo-Nazi and
SS-like symbols and regalia and openly
express neo-Nazi views. Their logo echoes
the Wolfsangel, one of the original symbols
used by the 2nd SS Panzer Division Das Reich.
Representatives of the Azov Battalion,
however, have claimed their symbol is an
abbreviation for the slogan “National Idea”
in Ukrainian.
Ukrainian
authorities did not bother to conceal the
fact that in 2014, Azov comprised
neo-Nazi-leaning volunteers from countries
such as Sweden, Italy, France, Belarus,
Canada, and Slovenia.
Despite the adoption
of the 2015 Minsk Accords that were
aimed at ending the civil war by
reintegrating the Donbass into Ukraine in
exchange for constitutionally-guaranteed
autonomy, Kiev refused to implement a
peace deal. Azov members took an active
part in Donbass hostilities.
In 2016, the Office
of the UN High Commissioner for Human Rights
(OHCHR) accused the Azov Battalion,
officially upgraded to a regiment in January
2015, of committing war crimes such as
mass looting, unlawful detention, and
torture. Currently, the Azov “Special
Operations Detachment” is engaged in the
Ukrainian army’s counter-reconnaissance and
special weapons operations.
The Russian
Investigative Committee has opened a
criminal case against a number of fighters
from Azov units for crimes such as
kidnapping, torture, use of prohibited
means, and methods of warfare.” (“Ukrainian
bad guys and a fair Russian response”,
Batko Milacic for the Saker Blog)
Again, these are not your
garden-variety, right-wing militants. These are
full-fledged, battle-hardened Nazi storm
troopers that have engaged in all-manner of
illegal and sadistic activities including “the
mass killing of prisoners, the concealment of
corpses in mass graves and the systematic use of
physical and psychological torture techniques.” And while they are lavishly supported by the
United States, they oppose everything that
America claims to stand for. They are
universally opposed to liberal democracy,
parliamentary government and racial equality.
Instead, they advocate social regimentation,
autocratic rule and glorification of the state.
Race is very much at the core of Nazi Doctrine.
(which may explain the animus these fascist
groups have for the ethnic Russians in the
east.) A few quotes from Hitler’s manifesto Mein
Kampt help to illustrate this point:
“A stronger race
will drive out the weaker ones, for the
vital urge in its ultimate form will break
down the absurd barriers of the so-called
humanity of individuals to make way for
the humanity of nature which destroys the
weak to give their place to the strong.”
“Blood sin and
desecration of the race are the original sin
of this world and the end of a humanity that
surrenders to it.” (“Adolf
Hitler, Quotes on Race”, quotetab)
The above quotes provide
a window into the ideology that was used to
justify a world war against “inferior people”
who were seen as expendable in the eyes of their
Aryan overlords. Why– you may ask– is the US
supporting the adherents of this same fiendish
dogma in Ukraine today?
We can’t answer that, but
here’s more background from an article by
Monseigneur Carlo Maria Vigano:
“Neo-Nazi
movements engaged in military and
paramilitary actions operate freely in
Ukraine, often with the official support of
public institutions. These include the
following: Stepan Bandera’s Organization of
Ukrainian Nationalists (OUN), a movement
with a Nazi, anti-Semitic and racist matrix
already active in Chechnya and which is part
of the Right Sector, an association of
far-right movements formed at the time of
the Euromaidan coup in 2013/2014; the
Ukrainian Insurgent Army (UPA); the
UNA/UNSO, paramilitary wing of the far-right
political party Ukraine National Assembly;
the Korchinsky Brotherhood, which offered
protection in Kiev to ISIS members;
Misanthropic Vision (MD), a neo-Nazi network
spread across 19 countries that publicly
incites terrorism, extremism and hatred
against Christians, Muslims, Jews,
Communists, homosexuals, Americans and
people of color.
It should be
remembered that the government has given
explicit support to these extremist
organizations both by sending the
presidential guard to the funerals of their
representatives, as well as by supporting
the Azov Battalion, a paramilitary
organization that is officially part of the
Ukrainian Army under the new name of Azov
Special Operations Regiment and organized
into the National Guard. ..
In March 2015,
Ukrainian Interior Minister Arsen Avakov
announced that the Azov Battalion would be
one of the first units to be trained by US
Army troops, as part of their Operation
Fearless Guard training mission. … “We have
been training these guys for eight years
now. They are really good fighters. That’s
where the Agency’s program could have a
serious impact.” (“Declaration
of Msgr. Carlo Maria Viganò on the
Russia-Ukraine Crisis”,
marcotosatti.com)
Vigano is right, the US
has been providing combat training to Ukrainian
Nazis and other far-right groups in secret camps
since 2015. These ultra nationalist militias
will now pass along these same skills to tens of
thousands of other like-minded militants
increasing the global spread of fascism by many
orders of magnitude. Here’s more from an article
at Jacobin Magazine:
“Not just the
Ukrainian far right, but neo-fascist forces
from all over the world, including the US
and Europe, will now receive combat
experience with the most advanced weapons in
the world. They will also be able to
continue developing their international
networks, to which the Ukrainian far right,
and especially the Azov Battalion, have long
been central…
… since 2015, the CIA
has been secretly training forces in Ukraine
to serve as “insurgent leaders,” in the
words of one former intelligence official,
in case Russia ends up invading the country.
Current officials are claiming the training
is purely for intelligence collection, but
the former officials Yahoo! spoke to said
the program involved training in firearms,
“cover and move,” and camouflage, among
other things.
Given the facts,
there’s a good chance that the CIA is
training actual, literal Nazis as part of
this effort. The year the program started,
2015, also happened to be the same year that
Congress passed a spending bill that
featured hundreds of millions of dollars’
worth of economic and military support for
Ukraine… (“The
CIA May Be Breeding Nazi Terror in Ukraine”,
Branko Marcetic, Jacobin Magazine)
But why has the United
States gone to so much trouble to arm and train
these combatants when it appears that the
Russian army is clearly going to win the war?
The plan to defeat
Russia was never intended to succeed in the
initial phase of the conflict, but to lay the
groundwork for a bloody and protracted
insurgency fought by these same CIA-trained
paramilitaries who now act as Uncle Sam’s Nazi
warriors. Here’s the story from Yahoo News:
“The CIA is
overseeing a secret intensive training
program in the U.S. for elite Ukrainian
special operations forces and other
intelligence personnel, according to five
former intelligence and national security
officials familiar with the initiative. The
program, which started in 2015, is based at
an undisclosed facility in the Southern
U.S., according to some of those officials….
The training, which
has included “tactical stuff,” is “going to
start looking pretty offensive if Russians
invade Ukraine,” said the former official.
One person familiar with the program put it
more bluntly. “The United States is
training an insurgency,” said a former CIA
official, adding that the program has taught
the Ukrainians how “to kill Russians.”
Though the
agency’s paramilitary resources have been
otherwise stretched thin in Afghanistan and
on other counterterrorism missions, the
U.S.-based training program has been a “high
priority” for the CIA since its Obama-era
inception, said the former senior
intelligence official…. The Biden
administration has reportedly assembled a
task force to determine how the CIA and
other U.S. agencies could support a
Ukrainian insurgency, should Russia launch a
large-scale incursion.
“If the Russians
invade, those [graduates of the CIA
programs] are going to be your militia, your
insurgent leaders,” said the former senior
intelligence official. “We’ve been training
these guys now for eight years. They’re
really good fighters. That’s where the
agency’s program could have a serious
impact.”
Both U.S. and
Ukrainian officials believe that
Ukrainian forces will not be able to
withstand a large-scale Russian incursion,
according to former U.S. officials. But
representatives from both countries also
believe that Russia won’t be able to hold on
to new territory indefinitely because of
stiff resistance from Ukrainian insurgents,
according to former officials.
If the Russians
launch a new invasion, “there’s going to be
people who make their life miserable,”
said the former senior intelligence
official. The CIA-trained paramilitaries
“will organize the resistance” using the
specialized training they’ve received.
The United States has been arming and
training Ukrainian fascist combatants in
secret locations.
The CIA training program began in
2015 which suggests there must have been a
plan for goading Russia into invading.
Nothing would have been left to chance.
Strategic planners must have settled on what
provocations they would use. (like the
threat of NATO membership)
Official Washington never thought the
Ukrainian army could prevail against a
conflict with the Russian Army, which
suggests that the media’s stories about “the
brave Ukrainian resistance” are reckless
propaganda designed to garner greater public
support.
The country of Ukraine and the Ukrainian
people are of no interest to the United
States. Ukraine is only valuable in as
much as it provides a staging ground (and
the manpower) for Washington to prosecute a
war against Russia.
The clear strategic objective of the
CIA program is to create an
“Afghanistan-type” quagmire for Russia
that will deplete its resources, inflict
massive reputational damage, and kill as
many Russian servicemen as possible.
The ultimate goal of the
CIA-generated insurgency is to destroy
the Russian economy, isolate the Russian
leadership, and send home as many Russian
boys in body-bags as possible in order to
affect a regime change that will replace
arch-rival Putin with a compliant stooge
like Ukrainian Puppet Zelensky.
All the evidence suggests that the
developments on the ground– including the
luring of Russian troops into Ukraine– is
part of a long-standing strategic plan to
prevent the economic integration of Russia
and Europe in order to control China’s
development and preserve US hegemony into
the next century. Thus, current US
foreign policy can be summarized in just 10
words:
“We’ll deal with
Russia first, then move on to China.
French,
translation- Note-
Translation may take a moment to load.
==========================================
*Boonman ziet het vooral als zijn taak om de disfunctionerende VVD premier Rutte en diens kabinetten te prijzen en dat durft zich ook nog journalist te noemen…….
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar berichten over de oneindige VS terreur:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!!
Ongelofelijk wat een hysterische hypocrisie zich meester heeft gemaakt van de westerse wereld, met een nooit eerder geziene enorme dosis anti-Russische propaganda, worden de westerse volkeren gehersenspoeld en elke kritiek daarop, hoe steekhoudend ook, wordt afgedaan als zou deze zijn gedaan door Russische trollen en agenten die uit zijn op de vernietiging van het westen…….
Ongelofelijk ook te zien hoe de VS de anti-Russische propaganda leidt, terwijl dat land in vergelijking met Rusland enorm veel meer kwaad heeft gebracht en brengt over de wereld, zo heeft de VS alleen deze eeuw al meer dan 5 miljoen mensen vermoord in illegale oorlogen, geheime militaire acties en illegale executies middels drones, waar de VS die executies uitvoert op verdachten (dat wordt internationaal als een zware misdaad gezien) en waarbij meer dan 90% van de slachtoffers niet eens werd verdacht…….
De VS had ook een uiterst grote bek over een aanval op een geboortekliniek en kinderziekenhuis, wat Rusland in de schoenen is geschoven (wat nog maar moet worden bewezen), terwijl de VS de laatste 21 jaar meerdere ziekenhuizen in puin heeft geschoten of gebombardeerd en zelfs een ziekenhuis van Artsen Zonder Grenzen (MSF) in Afghanistan heeft aangevallen, waarbij de leiding van dat ziekenhuis het VS oppercommando meer dan een uur heeft gesmeekt te stoppen met de beschietingen, waaraan pas na meer dan een uur werd voldaan, ook daarbij heeft de VS een flink aantal mensen vermoord, waaronder artsen……
Ook heeft de VS een grote bijdrage geleverd en doet dat nog aan de genocide op de sjiitische bewoners van Jemen, waarbij meer dan 500.000 mensen zijn omgekomen, waaronder een jaar geleden al meer dan 100.000 kinderen…… De sjiieten werden en worden uitgehongerd, geplaagd door cholera en difterie…… De Saoedische terreurcoalitie heeft hele woonwijken, gemeenschapscentra, scholen, moskeeën, waterzuiveringsinstallaties, waterbronnen, akkers en ziekenhuizen, zoals een splinternieuw ziekenhuis van Artsen Zonder Grenzen platgegooid, dat laatste MSF ziekenhuis zou in gebruik worden genomen in de strijd tegen cholera…… Honger en ziekten daar zijn veroorzaakt door die terreurcoalitie met hulp van de VS, Groot-Brittannië en Frankrijk, waar de VS zelf af en aan militair optreedt in dat land en meehelpt aan de zeeblokkade, waarbij (bewezen) meermaals schepen met hulpgoederen werden teruggestuurd…… Welke westerse politici, media en burgers hebben zich daar druk om gemaakt, terwijl die genocide al jaren gaande is…… (zelfs Nederland levert wapenonderdelen aan de hoofdverantwoordelijke voor die genocide >> de reli-fascistische terreurstaat Saoedi-Arabië, terwijl ‘ons koningshuis’ goede banden onderhoudt met de despoten van dat land……)
In het artikel van Caitlin Johnstone (hieronder opgenomen) geeft ze aan dat de propaganda zover gaat dat Facebook en Instagram hun gebruikers toestaan om op te roepen tot de dood van Russen en Putin in het bijzonder…… Hoe krankzinnig ziek in je kop moet je als CEO van zo’n bedrijf zijn om dit toe te staan, immers je roept in feite op om Russische minderheden in diverse buitenlanden aan te vallen en desnoods te vermoorden (de nazi’s zouden hier jaloers op zijn geweest, wereldwijd mensen mogen oproepen om Joden aan te vallen en te vermoorden……) Normaal gesproken wordt je onmiddellijk van Facebook gegooid als je oproept tot geweld…….
Over nazi’s en geweld gesproken: vorige maand al heeft Facebook toegestaan om het Azov neonazi-bataljon van het Oekraïense leger (één van die bataljons) te prijzen, terwijl deze schoften vanaf 2014 al een enorm aantal burgers hebben verjaagd dan wel vermoord in de afgescheiden staatjes Luhansk en Donetsk, de burgers daar hebben zich afgscheiden van Oekraine omdat ze het niet eens waren met de door de VS georganiseerde en geregisseerde opstand en coup, die een eind maakte aan het bewind van de door hen democratisch gekozen president Janoekovytsj, die door de VS werd vervangen door de zwaar corrupte neonazi Porosjenko…….
Caitlin vraagt zich in de kop van haar artikel af of wij de slechten zijn, welnu gezien de meer dan achterlijke anti-Russische propaganda en het totaal blind zijn voor het grote fascistische gehalte van niet alleen Oekraïne, maar ook van andere Oost-Europese landen, kan je niet anders dan concluderen dat we inderdaad de slechten zijn…… Waarom heeft niemand zich druk gemaakt om de meer dan 13.000 burgers van de staatjes Luhansk en Donetsk die werden vermoord bij de doorgaande beschietingen en bombardementen van de Oekraïense neonazi-bataljons?? Bataljons die keer op keer de wapenstilstanden hebben geschonden en die weigerden om de zware wapens terug te trekken, zoals meermaals werd afgesproken in Minsk……
Waarom hebben de westerse media die nu zo’n grote propaganda bek hebben nooit kritiek geleverd op de uitbreiding van de NAVO, terwijl meermaals was afgesproken dat dit niet zou gebeuren??? Waarom hebben diezelfde media nooit kritiek geleverd op de voortdurende NAVO-oefeningen langs de Russische westgrens en haar territoriale wateren, waarbij zelfs werd geoefend op het binnenvallen van Russisch grondgebied….. Nee als Rusland een oefening hield in de buurt van die grens dan pas kwamen die media in beweging en spraken daar schande van, alsof Rusland niet oefende op eigen grondgebeid maar op westers grondgebied….. Daarnaast gaat het hier maar om een paar militaire oefeningen, in tegensteling tot de NAVO oefeningen die bijna het jaarrond worden gehouden……
De westerse propaganda heeft een fiks aantal mensen knettergek gemaakt en heb nu al 2 keer (vanmorgen op BBC Scotland de tweede keer) gehoord dat inbellers op radioprogramma’s opriepen tot het aanvallen van Rusland met kernwapens…. Op de vraag van de presentator dat ze daarvan zelf het slachtoffer zouden kunnen worden, antwoorden deze mafketels dat dit dan maar moet…….. Ga maar na wat er nodig is om mensen op een dergelijk dood spoor te zetten……
Bijna nog gekker: gisteravond op CBC Radio1 een psycholoog die de luisteraar voorhield niet alles over de oorlog in Oekraïne te vertellen aan kinderen, dat zou ze maar onnodig ongerust maken (onthoud dit even)….. Blijkbaar is deze kinderpsycholoog niet op de hoogte van het feit dat het gros van de kinderen een smartphone heeft en daarmee alles kan volgen wat daar gebeurt, bovendien zijn er altijd een paar kinderen die ‘wel op de hoogte zijn’ (van de westerse propaganda) en dat maar al te graag uitdragen op school of bij vrienden (v/m)….. Ongelofelijk maar deze ‘psycholoog’ noemde de oorlog in Oekraïne een ‘approaching war’, ofwel een ‘naderende of komende oorlog’, waarmee deze kwezel in feite de luisteraar nog meer angst aanjaagde….. (en natuurlijk zijn er kinderen die de woorden van deze psycholoog op de één of andere manier opvangen) Waarom zou een oorlog in Oekraïne zich uitbreiden naar Canada, dat is alleen mogelijk als het westen zich actief in deze oorlog mengt en daarmee een Derde Wereldoorlog uitlokt…….
Al moet ik na het voorgaande zeggen, dat de westerse propaganda zover gaat dat men zelfs een kernoorlog met Rusland wil riskeren, tel hierbij op dat meerdere VS generaals eerder al hebben laten weten dat een ‘beperkte kernoorlog’ tegen Rusland (en China) is te winnen….. Biden was als vicepresident onder Obama overigens mede schuldig aan het het besluit kernwapens niet langer te zien als afschrikkingswapen, ofwel als jij een kernwapen tegen mij inzet sla ik op dezelfde manier terug, maar het kernwapen in het vervolg te zien als eerste aanvalswapen….. De Britse regering onder hare kwaadaardigheid May heeft zich daar destijds ook achter geschaard (GB is immers ook een kernwapenstaat) Dit besluit van de VS en GB wekte amper belangstelling in de westerse reguliere media, echter toen Rusland een paar maanden later, in feite gedwongen, hetzelfde liet weten, waren de rapen pas echt gaar in diezelfde media en schreeuwde men moord en brand…….
Als men in verhouding zo tekeer was gegaan als nu tegen Rusland maar dan tegen de illegale oorlogen en enorme slachtpartijen die de VS alleen deze eeuw al heeft aangericht, was de VS volkomen geïsoleerd geweest en was het land al lang helemaal failliet geweest (dat is het land overigens eigenlijk al lang, maar het SWIFT betalingssysteem, de petrodollar en het dag en nacht bijdrukken van geld houdt het land nog op de been)…… Nogmaals: wat Rusland doet kan nog niet in de schaduw staan van wat de VS deze eeuw allemaal heeft geflikt >> meer dan 5 miljoen mensen vermoord….. (met hulp van de andere NAVO-lidstaten, waaronder Nederland dat zich ook schuldig maakte aan vreselijke oorlogsmisdaden…..)
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
(als
je het Engels niet machtig bent, kopieer dan de Engelse tekst en plak
die in deze
vertaalapp,
de app werkt snel en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt kan je kiezen voor Nederlands)
Reuters reports
that Facebook and Instagram are now allowing calls for the death of
Russians and Russian leaders in exemption from the platforms’ hate
speech terms of service due to the war in Ukraine:
“Meta
Platforms will allow Facebook and Instagram users in some countries to
call for violence against Russians and Russian soldiers in the context
of the Ukraine invasion, according to internal emails seen by Reuters on
Thursday, in a temporary change to its hate speech policy.”
Twitter
has also altered its rules against incitement and death threats in the
case of Russian leaders and military personnel, as Ben Norton explains here for Multipolarista.
Last month we also learned
that Facebook is now allowing users to praise the Ukrainian neo-Nazi
Azov Battalion because of the war, a move that is arguably the most
liberal thing that has ever happened.
Reuters World
@ReutersWorld
Exclusive: Facebook will temporarily allow posts calling for violence against Russians, calls for Putin’s death http://reut.rs/3KzBIYp
Normally
when the US and its allies are involved in a war they’ll at least pay
lip service to the notion that they have nothing but good will for the
people of the enemy nation, claiming they only oppose their oppressive
rulers. With Russia it’s just a complete rejection of the entire
culture, the entire ethnicity. It’s a widespread promotion of hatred
for the actual people because of who they are.
These are the people who are being smashed with crushing economic sanctions while western pundits proclaim that “There are no more ‘innocent’ ‘neutral’ Russians anymore” and ask “At what point do you hold a people responsible for putting an evil despot in power?” This even as the Russian people are being arrested by the thousands
in anti-war protests, putting to shame our own western society that has
generally slept through war after war in the years since 9/11 while our
militaries have been killing of millions of people.
And this is all over a war that the western empire knowingly provoked, almost certainly planned in advance, and appears to be doing everything possible to ensure that it continues. Antiwar’s Dave DeCamp reports
that Washington is still to this day not engaging in any serious
diplomacy with Moscow over this conflict, preferring to strangle Russia
economically and pour weapons into Ukraine to make the war as painful
and costly as possible. Both of these preferences just so happen to
nicely complement the US empire’s goal of unipolar planetary hegemony.
Meanwhile
the entire western political/media class seems to be doing everything
it can to turn this from a regional proxy war into a very fast and
radioactive World War 3. Calls for a no-fly zone over Ukraine, which would require directly attacking the Russian military and risking a nuclear exchange in the resulting escalations, are now ubiquitous. Claims that more directly confrontational military aggressions against Russia won’t start a nuclear war (or that it’s worth the risk anyway) are becomingmore and more common in western punditry. Democrats are braying for Russian blood while Republicans like Tom Cotton and Mitt Romney are
attacking Democrats for being insufficiently hawkish and escalatory in
this conflict, creating a horrifying dynamic where both parties are
trying to out-hawk each other to score political points and nobody is
calling for de-escalation and detente.
As luck would have it, US officials have also selected this precarious nuclear tightrope walk as the perfect time to begin hurling accusations
that Russia is preparing a biological attack, potentially as a false
flag blamed on Ukraine or the United States. This coincides with
Victoria Nuland’s admission
before the Senate Foreign Relations Committee that Ukraine has
“biological research facilities” that the US is “quite concerned” might
end up “falling into the hands of Russian forces”.
All of this on top of the unprecedented wave of authoritarian censorship that has been tearing through the US-centralized empire as our rulers work to quash dissident voices around the world.
It certainly is interesting that the fight for freedom and democracy
requires so much censorship, warmongering, xenophobia, propaganda and
bloodlust.
I
am of course only trying to make a point here. Geopolitical power
struggles are not contested by opposing sides of heroes and baddies like
a Marvel superhero movie, though you’d never know it from all the hero
worship of Volodymyr Zelensky and the self-righteous posturing of
mainstream westerners over this war. Vladimir Putin is no Peter Parker,
but neither is Zelensky or Biden or any of the other empire managers
overseeing this campaign to overwhelm all challengers to US global
domination.
The
power structure loosely centralized around the United States is without
question the single most depraved and destructive on earth. No one else
has spent the 21st century waging wars that have killed millions and
displaced tens of millions. No one else is circling the planet with
military bases and working to destroy any nation on earth which disobeys
it. Not Russia. Not China. Nobody.
The
hypocrisy, dishonesty and phoniness of this whole song and dance about
Ukraine is one of the most distasteful things that I have ever
witnessed. Rather than engaging in click-friendly Instagram activism
with blue and yellow profile pics making risk-free criticisms of a
foreign leader in a far off country who has nothing to do with us,
perhaps we would be better served by a bit more introspection, and by a
somewhat more difficult stance: intense scrutiny of the corruption and
abuses running rampant in our own society.
_______________________
My work is entirely reader-supported, so if you enjoyed this piece please consider sharing it around, following me on Facebook, Twitter, Soundcloud or YouTube, or throwing some money into my tip jar on Ko-fi, Patreon or Paypal. If you want to read more you can buy my books. The best way to make sure you see the stuff I publish is to subscribe to the mailing list for at my website or on Substack, which will get you an email notification for everything I publish. Everyone, racist platforms excluded, has my permission to
republish, use or translate any part of this work (or anything else
I’ve written) in any way they like free of charge. For more info on who I
am, where I stand, and what I’m trying to do with this platform, click here.
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar berichten over de oneindige VS terreur:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!!
De VVD heeft een verkiezingsaffiche waarmee het een deel van de Nederlanders keihard in het kruis trapt, op de affiche is te lezen dat een uitkering een lekkere hangmat is…….. Een uitermate onbeschofte verkiezingsleus die volkomen voorbijgaat aan het feit dat een groot deel van de huidige werklozen dit te danken hebben aan het afbraakbeleid van de kabinetten Rutte 1 t/m 4……
Ook gaat deze ploertenleus voorbij aan het feit dat de kabinetten Rutte weigeren iets te doen aan de vele bedrijven die gebruikmaken van Oost-Europese werknemers, daar ze deze werknemers onder het minimumloon kunnen betalen en hen voorts geld afhandig maken voor veel te duur onderdak, zo krijgen ze zelfs geld terug dat ze eerder aan salaris hebben betaald….. Om gebruik te kunnen blijven maken van deze buitenlandse arbeidsslaven, worden deze in ploegen voor een half jaar aangenomen om daarna ontslagen te worden en vervangen worden door een andere ploeg, die vervolgens na een half jaar ontslagen wordt, waarna men de eerste ploeg weer aanneemt >> zo behoeft men zich niet aan de CAO te houden….
De VVD is samen met partijen als de PvdA, CDA en D66 (plus uiteraard de fascisten van de PVV en FVD) verantwoordelijk voor schandelijke uitlatingen als zouden uitkeringsgerechtigden te lui zijn om in de tuinbouw te werken (waar men o.a. de hiervoor uitgelegde manier van uitbuiten gebruikt), echter de werkelijkheid laat telkens weer zien dat Nederlandse werkgevers niet zitten te wachten op Nederlandse arbeiders, juist daar ze hen het wettelijk minimumloon moeten betalen en zich aan de CAO moeten houden………
Waar ik me nu ook al weer jaren aan erger zijn de mensen die in fel gele pakken langs de straten staan om zinloos het verkeer te regelen, kan dat niet anders zien dan een vorm van straf voor werkloosheid…. In weer en wind urenlang langs de straten, kruispunten en doorgaande wegen staan, waarbij deze mensen grote hoeveelheden auto-uitstoot inademen en dan te bedenken dat alleen in Nederland jaarlijks rond de 18.000 mensen niet maanden maar jaren eerder overlijden ten gevolge van langdurige auto-uitstoot inademing….. (en dat meestal na een akelig ziekbed) Reken gerust dat hier ook een flink aantal rokers tussen zit, al worden die meegerekend aan de rond de 20.000 doden die jaarlijks door roken jaren eerder sterven, immers veel beroepschauffeurs zijn rokers……
Het is te hopen dat de kiezers eindelijk de VVD gaan straffen voor het afbraakbeleid dat deze partij heeft gevoerd, zo is deze partij de hoofdverantwoordelijke voor het sluiten van ziekenhuizen, het verdwijnen van IC bedden, IC verpleegkundigen en intensivisten…. Toen het kabinet Rutte 1 aantrad had Nederland nog 2.200 IC bedden, wat was afgenomen tot 1.100 toen de Coronacrisis uitbrak begin 2020……. Totaal onverantwoord, zeker als je bedenkt dat het aantal ouderen steeds groter wordt en dat het kabinet Rutte 2 en daarmee Rutte 3 en 4 in 2016 door de AIVD en MIVD zijn gewaarschuwd dat Nederland niet klaar was voor een pandemie, juist vanwege het tekort aan IC bedden, gewone ziekenhuisbedden, IC verpleegkundigen en intensivisten…. In plaats van daar actie op te ondernemen, hebben Rutte 2 en 3 verder bezuinigd op de zorg waardoor er nog meer ziekenhuizen werden gesloten (op verzoek van de zorgverzekeraars-schoften, die zelf een fiks deel van de zorgtaart opvreten), en er logischerwijs nog meer IC verpleegkundigen en intensivisten verdwenen….. De partijen die deelnamen aan Rutte 3 lieten herfst vorig jaar weten dat men niet van zins was meer IC bedden te creëren, zoals de rest van de Kamer wilde en Rutte 4 heeft aangegeven nog meer op de zorg te willen bezuinigen…….
Gevolg van dit wanbeleid op de zorg waren de ongrondwettelijke en burgerrechten-schendende Coronamaatregelen, waar het kabinet Rutte 3 het gore lef had deze te legitimeren daar er te weinig IC bedden en verpleegkundigen waren, wat dat kabinet en haar voorgangers NB zelf hebben gecreëerd…… Onbegrijpelijk dan ook dat bij de vorig jaar gehouden Tweede Kamerverkiezingen de VVD weer als grootste uit de bus kwam…. Ik begrijp wel dat de media daar een grote rol in hebben gespeeld, met hun continue bipslikken van Rutte als ‘geweldig premier’, maar je mag van de bevolking toch enigszins gezond verstand verwachten en men zou zelf toch moeten kunnen inzien dat Rutte en zijn VVD de oorzaak zijn van heel veel ellende, zelfs al was het alleen maar vanwege de rampzalig verlopen Coronacrisis…….
Dan nog de enorme hoeveelheid leugens waarop Rutte is betrapt sinds hij in 2010 premier werd, onbegrijpelijk dat men dat in het stemlokaal blijkbaar allemaal vergeten is….. Vooral de leugen die deze schoft jaar in jaar uit herhaalt op Prinsjesdag, dat iedereen er volgend jaar op vooruitgaat, terwijl de grote onderlaag er in feite alleen maar op achteruit is gegaan en de welgestelden hun vermogen met dubbelcijferige percentages zagen groeien…… In het hieronder overgenomen schrijven van Linkedin wordt gesproken over 1,2 miljoen arme Nederlanders, echter als je alle mensen meerekent die tegen, op of onder de armoedegrens moeten leven meerekent (die 3 groepen leven allen in armoede) ga je de 3 miljoen ver voorbij en het aantal kinderen dat daarbij hoort gaat de 400.000 ver te boven……. Vergeet hierbij niet dat de armoedegrens is vastgesteld door dik verdienende ambtenaren en politici…….
Met deze affiche zaait de VVD ook nog eens haat tegen een fikse bevolkingsgroep en dat voor een feit waaraan zogezegd de VVD zelf de hoofdschuldige is……. Alleen daarom zou de VVD al vervolgd moeten worden!! (tweespalt veroorzaken en demonisering van een minderheid zou zwaar moeten worden gestraft)
Tot slot nog even de partijen die medeverantwoordelijk zijn voor de afbraak van de zorg, naast de VVD: CDA, D66, PvdA, ChristenUnie, PVV en de SGP….. (de laatste vanwege de steun van die partij voor de kabinetten Rutte 1 t/m 4)
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
Voorzitter Landelijke Clientenraad en Senior Onderzoeker Sociale Veiligheid bij Movisie
3 d • Bewerkt •
3 dagen geleden
Vanmorgen zag ik deze foto. Ik heb me even moeten
bedenken of ik vanuit mijn rol hier iets over moet zeggen. Het is te
politiek. En ik moet politiek neutraal zijn. Maar ik doe het toch. Want
het is kwalijk wat hier gebeurt. Het is schadelijk voor
uitkeringsgerechtigden. 1,2 miljoen Nederlanders leven in armoede,
waarvan ruim 200.000 kinderen. Velen van hen hebben een
bijstandsuitkering. Dat zijn mensen die vaak aangewezen zijn op de
voedselbank om te kunnen eten. Mensen die verjaardagen van kinderen
moeten overslaan omdat ze geen geld hebben voor een traktatie op school.
Mensen waarvan de kinderen niet naar verjaardagen van vriendjes kunnen
omdat er geen geld is voor kadootjes. Mensen die bij aanvang van de
winter zich moeten afvragen: betaal ik de energierekening of koop ik
warme winterjassen voor de kinderen. Mensen die fysiek en psychisch ziek
zijn omdat ze gebukt gaan onder stress. Stress door het gebrek aan
geld. Stress door oplopende schulden. Stress door gebrek aan
perspectief.
Ooit is de hardvochtigheid jegens mensen die vaak
tegen wil en dank aanspraak moeten maken op de bijstand, dat overigens
een RECHT is, ooit ontstaan. Door dit soort ideeën. Aangezwengeld vanuit
de politiek.
We weten nu beter. Bestaanszekerheid wordt wel 1000 keer genoemd in het coalitieakkoord. En dat is met een reden.
Met
man en macht wordt momenteel zowel door politici als ambtenaren op
lokaal en nationaal niveau gewerkt aan herstel. Er wordt hard gewerkt
aan de responsieve overheid die bestaanszekerheid moet bieden aan alle
burgers. We breken ons hoofd over hoe we de hardvochtigheden in de
wetgeving kunnen weghalen. Niet voor niets houden wethouders van grote
steden en daarbuiten een warm pleidooi om de Participatiewet te
vermenselijken en het minimumloon gekoppeld aan uitkeringen te
verhogen. Dit doen zij omdat zij de ellende van hun inwoners meemaken en
hier iets aan willen doen. Meer dan de helft van de gemeenten in
Nederland zoekt de randen van de wet op om de Participatiewet aan te
passen.
De Minister voor armoedebestrijding en participatie gaf notabene aan de Participatiewet fundamenteel te herzien.
En dan komt de VVD In Hellendoorn hiermee aanzetten.
Ik
weet het, ooit stond ik in jullie schoenen. Ooit was ik ook een
politica. Ik ken dat: het is verkiezingstijd en je moet op zoek naar
oneliners en slogans die lekker bekken en het electoraat aanzetten een
stem op jou uit te brengen. Maar doe dit niet. Je wilt niet over de rug
van mensen die al de grond ingetrapt zijn en aan het overleven zijn in
plaats van leven stemmen binnen halen. Ik kan het me niet voorstellen.
Mijn pubers van 13 en 14 zouden zeggen: “zo kan je niet zijn.”
SCHANDE en dat van een partij die tijdens de bankencrisis onnodig een paar honderdduizend mensen werkloos heeft gemaakt, waar velen van hen nooit meer aan de bak zijn gekomen >> ‘te oud…..’
Voor meer berichten over Rutte, Rutte 2, Rutte 3, armoede, bijstand, Coronavirus, IC bedden, Zorgverzekeraars Nederland, enz. >> klik op het betreffende label, direct onder dit bericht.
Glenn Greenwald heeft een artikel gepubliceerd waarin hij aangeeft dat Victoria Nuland verrassend genoeg heeft toegegeven dat de VS onderzoekslaboratoria heeft in Oekraïne, voorts wordt middels dit artikel nog eens aangegeven dat de VS Oekraïne in feite bestuurt…..
Volgens Greenwald hebben zelfbenoemde ‘fact checkers’ van de reguliere media wekenlang geprobeerd om berichten dat er In Oekraïne biologische onderzoekslaboratoria zijn die ofwel door Oekraïne zelf dan wel met hulp van de VS worden geleid, af te doen als fake news (nepnieuws) en samenzweringstheorieën….. Eén en ander zonder dat deze ‘fact checkers’ ook maar één bewijs gaven voor hun uitlatingen, men moet ze maar op de blauwe ogen geloven. Greenwald vraagt zich hierbij af hoe ze aan de kennis over die laboratoria komen en hoe kunnen ze daarbij de boel ontkennen……
Berichten dat Oekraïne gevaarlijke biologische wapens heeft komen van Rusland en China. Het Chinese ministerie van buitenlandse zaken ging nog verder en stelde daarbij dat de VS 336 van deze biologische onderzoekslaboratoria heeft verspreid over 30 landen en dat de VS er in Oekraïne alleen al 26 heeft (laboratoria geleid door de VS)…… Het Russische ministerie van buitenlandse zaken liet weten dat het documenten in bezit heeft waaruit blijkt dat er in Oekraïne van deze laboratoria in de buurt van de Russische grens staan waar men werkt aan het ontwikkelen van onderdelen van biologische wapens……. Deze claim moet als die van de fact checkers met scepticisme worden bekeken totdat er bewijs voor wordt geleverd, echter de fact checkers in de VS hebben deze claim meteen afgedaan als desinformatie en als een samenzweringstheorie als die van QAnon……..
Afgelopen maandag werd deze als neutraal en hoogdravend vermomde propaganda van de fact checkers doorgeprikt >> de neocon beambte die verantwoordelijk is voor de VS politiek in Oekraïne werd gehoord door de senaatscommissie voor buitenlandse betrekkingen en deze stelde dat deze door de fact checkers als onzin afgedane claims, deels waar zijn……. Afgelopen dinsdagmiddag getuigde Victoria Nuland, de staatssecretaris politieke zaken* van de VS, voor dezelfde commissie. De Republikeinse senator Marco Rubio, die hoopte de bewering onderuit te halen dat er chemische en biologische wapenlaboratoria zijn in Oekraïne, vroeg Nuland of Oekraïne chemische of biologische wapens heeft, waarbij hij ervan uitging dat het antwoord negatief zou zijn.
Echter geheel tegen Rubio’s verwachting in en tegen wat men van neocon Nuland zou verwachten, als zou zij e.e.a. afdoen als een samenzweringstheorie van de Chinese Communistische Partij (CCP) het Kremlin of QAnon, stelde ze nu dat het waar is…… Om de schade te beperken vroeg Rubio Nuland of ze het ermee eens is dat mocht er een biologische aanval plaatsvinden deze voor 100% zeker door Rusland zou worden gedaan, blij dat haar een uitweg werd geboden, bevestigde Nuland de woorden van Rubio…… ha! ha! ha! ha! ha! ha! ha! ha! ha! ha! ha! ha! ha! ha! ha! ha! Jezus wat een zootje mensen!!
De ‘schoonmaak’ door Rubio kwam echter te laat, toen Nuland werd gevraagd of Oekraïne chemische of biologische wapens heeft, ontkende Nuland dit niet, op een wijze die niet lijkt op haar normale harde manier van reageren erkende deze oorlogshitser dat Oekraïne biologische onderzoeklaboratoria heeft, waar ze aangaf dat het niet om onbenullige laboratoria ging door de toevoeging bang te zijn dat deze laboratoria in handen van de Russen zouden kunnen vallen (die daarmee kunnen bewijzen dat de VS verantwoordelijk is voor smerig en uiterst gevaarlijk onderzoek, niet alleen in Oekraïne maar in meerdere landen……..) Nuland vervolgde met te zeggen dat de VS overleg voert met de Oekraïense autoriteiten hoe te voorkomen dat ‘onderzoeksmateriaal’ in handen kan vallen van de Russen……
Intussen beschuldigt het westen Rusland van het gebruik van chemische wapens, terwijl Rusland dergelijke middelen al heel lang niet meer heeft ingezet, dat plus het feit dat Oekraïense leger wel over biologische en chemische wapens beschikt doet toch ernstig vermoeden dat kwade krachten in Oekraïne proberen met een false flag operatie Rusland de schuld in de schoenen te schuiven……. (de neonazi-bataljons van het Oekraïense leger hebben totaal geen moeite om de eigen burgers om het leven te brengen, als ze daarmee de schuld bij de Russen kunnen leggen…….) De langzame opmars van het Russische leger wordt in het westen een mislukking genoemd van de legertop, echter de kans is veel groter dat Rusland zo min mogelijk burgerslachtoffers wil maken, zoals het ook handelde in Syrië toen het daar het leger bijstond in de strijd tegen de door het westen (ook door Nederland) gesteunde terreurgroepen……. Hoorde vannacht op BBC World Service dat men zelfs stelt dat Rusland chemische wapens zou hebben gebruikt in Syrië, een wel heel smerige leugen, terwijl de gifgasaanvallen die werden toegeschreven aan het reguliere Syrische leger, allen werden uitgevoerd door de terreurgroepen, zelfs Obama heeft dat als president toegegeven….. (het westen was zelfs op de hoogte van het feit [en had er geen moeite mee] dat deze groepen sarin en chlorine op voorraad hadden……)
Vergeet hierbij niet dat het verdrag waarmee een verbod is gelegd op ontwikkeling van biologische en anderszins giftige wapens door zowel Rusland als de VS is getekend. Dit verbod is een lachertje, immers de VS werkt zelfs in eigen land aan de ontwikkeling van biologische en chemische wapens, zogenaamd onderzoek naar de bestrijding van deze wapens als deze door een vijand van de VS zouden worden gebruikt, terwijl men bijvoorbeeld in het grote legerlaboratorum Fort Detrick een uitermate gevaarlijke variant heeft gemaakt van antrax, een variant die niet in de natuur voorkomt (deze werd na 9/11 verspreid in de VS)……. Overigens werd dit legerlaboratorium in de zomer van 2019 met spoed gesloten vanwege de ontsnapping van een uiterst gevaarlijk virus, een paar maanden later werden de militaire wereldspelen gehouden in Wuhan (met deelname van VS militairen) en naderhand is uitgekomen dat er in de VS al voor november 2019 besmettingen waren met COVID-19……. (overigens in voorjaar 2020 kwam men er in Frankrijk achter dat men al in november 2019 twee besmettingen had met COVID-19, dit door nader onderzoek van bloedmonsters die men in die novembermaand had afgenomen…..)
Glenn Greenwald gaat verder in op het gevaar van biologische en chemische wapens. Zoals al zo vaak op deze plek opgemerkt: hoe is het mogelijk dat er zelfs na de uitbraak van het Coronavirus nog steeds een groot aantal landen onderzoek doet naar het gebruik van biologisch en chemische wapens om deze daadwerkelijk te gebruiken tijdens oorlogsvoering….. Men ontwikkelt bijvoorbeeld virussen waartegen na besmetting niets is opgewassen!!! Hoe knettergek in je ‘wetenschappelijke bol’ moet je zijn om daaraan mee te werken??!!! Onlangs werd overigens bekend gemaakt dat zelfs farmaceut Pfizer zich bezighoudt met het ontwikkelen van virussen, dit om zo vaccins te kunnen ontwikkelen…… En ach als er zo’n virus ontsnapt, is het ping ping kassa voor de aandeelhouders van Pfizer (en een dikke bonus voor de CEO…..)….. Maar hoe is het mogelijk dat zelfs een farmaceut virussen mag ontwikkelen??!!! (niet één laboratorium zou dat mogen doen, laat staan een laboratorium van een privaat bedrijf…..)
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
(als
je het Engels niet machtig bent, kopieer dan de Engelse tekst en plak
die in deze
vertaalapp,
de app werkt snel en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt kan je kiezen voor Nederlands)
The
neocon’s confession sheds critical light on the U.S. role in Ukraine,
and raises vital questions about these labs that deserve answers
WASHINGTON,
DC – MARCH 08: Undersecretary of State for Political Affairs Victoria
Nuland testifies before a Senate Foreign Relation Committee hearing on
Ukraine on March 08, 2022 in Washington, DC. (Photo by Kevin
Dietsch/Getty Images)
Self-anointed “fact-checkers” in the U.S. corporate press have spent two weeksmocking asdisinformation and a false conspiracy theory
the claim that Ukraine has biological weapons labs, either alone or
with U.S. support. They never presented any evidence for their ruling —
how could they possibly know? and how could they prove the negative? —
but nonetheless they invoked their characteristically authoritative,
above-it-all tone of self-assurance and self-arrogated right to decree
the truth and label such claims false.
Claims
that Ukraine currently maintains dangerous biological weapons labs came
from Russia as well as China. The Chinese Foreign Ministry this month claimed: “The US has 336 labs in 30 countries under its control, including 26 in Ukraine alone.” The Russian Foreign Ministry asserted
that “Russia obtained documents proving that Ukrainian biological
laboratories located near Russian borders worked on development of
components of biological weapons.” Such assertions deserve the same
level of skepticism as U.S. denials: namely, none of it should be
believed to be true or false absent evidence. Yet U.S. fact-checkers
dutifully and reflexively sided with the U.S. Government to declare such
claims “disinformation” and to mock them as QAnon conspiracy theories.
Unfortunately
for this propaganda racket masquerading as neutral and high-minded
fact-checking, the neocon official long in charge of U.S. policy in
Ukraine testified on Monday before the Senate Foreign Relations
Committee and strongly suggested that such claims are, at least in part,
true. Yesterday afternoon, Under Secretary of State Victoria Nuland
testified before the Senate Foreign Relations Committee. Sen. Marco
Rubio (R-FL), hoping to debunk growing claims that there are chemical
weapons labs in Ukraine, smugly asked Nuland: “Does Ukraine have
chemical or biological weapons?”
Rubio
undoubtedly expected a flat denial by Nuland, thus providing further
“proof” that such speculation is dastardly Fake News emanating from the
Kremlin, the CCP and QAnon. Instead, Nuland did something completely
uncharacteristic for her, for neocons, and for senior U.S. foreign
policy officials: for some reason, she told a version of the truth. Her
answer visibly stunned Rubio, who — as soon as he realized the damage
she was doing to the U.S. messaging campaign by telling the truth —
interrupted her and demanded that she instead affirm that if a
biological attack were to occur, everyone should be “100% sure” that it
was Russia who did it. Grateful for the life raft, Nuland told Rubio he
was right.
But
Rubio’s clean-up act came too late. When asked whether Ukraine
possesses “chemical or biological weapons,” Nuland did not deny this: at
all. She instead — with palpable pen-twirling discomfort and in halting
speech, a glaring contrast to her normally cocky style of speaking in
obfuscatory State Department officialese — acknowledged: “uh, Ukraine
has, uh, biological research facilities.” Any hope to depict such
“facilities” as benign or banal was immediately destroyed by the warning
she quickly added: “we are now in fact quite concerned that Russian
troops, Russian forces, may be seeking to, uh, gain control of [those
labs], so we are working with the Ukrainiahhhns [sic] on how they can
prevent any of those research materials from falling into the hands of
Russian forces should they approach” — [interruption by Sen. Rubio]:
Nuland’s
bizarre admission that “Ukraine has biological research facilities”
that are dangerous enough to warrant concern that they could fall into
Russian hands ironically constituted more decisive evidence of the
existence of such programs in Ukraine than what was offered in that same
Senate in 2002 and 2003 to corroborate U.S. allegations about Saddam’s
chemical and biological programs in Iraq. An actual against-interest
confession from a top U.S. official under oath is clearly more
significant than Colin Powell’s holding up some test tube with an
unknown substance inside while he points to grainy satellite images that
nobody can decipher.
It
should go without saying that the existence of a Ukrainian biological
“research” program does not justify an invasion by Russia, let alone an
attack as comprehensive and devastating as the one unfolding: no more
than the existence of a similar biological program under Saddam would
have rendered the 2003 U.S. invasion of Iraq justifiable. But Nuland’s
confession does shed critical light on several important issues and
raises vital questions that deserve answers.
Any
attempt to claim that Ukraine’s biological facilities are just benign
and standard medical labs is negated by Nuland’s explicitly grave
concern that “Russian forces, may be seeking to gain control of” those
facilities and that the U.S. Government therefore is, right this minute,
“working with the Ukrainians on how they can prevent any of those
research materials from falling into the hands of Russian forces.”
Russia has its own advanced medical labs. After all, it was one of the
first countries to develop a COVID vaccine, one which Lancet, on February 1, 2021, pronounced was “ safe and effective” (even though U.S. officials pressured multiple countries, including Brazil, not to accept any Russian vaccine, while U.S. allies such as Australia refused for a full year
to recognize the Russian COVID vaccine for purposes of its vaccine
mandate). The only reason to be “quite concerned” about these
“biological research facilities” falling into Russian hands is if they
contain sophisticated materials that Russian scientists have not yet
developed on their own and which could be used for nefarious purposes — i.e., either advanced biological weapons or dual-use “research” that has the potential to be weaponized.
What
is in those Ukrainian biological labs that make them so worrisome and
dangerous? And has Ukraine, not exactly known for being a great power
with advanced biological research, had the assistance of any other
countries in developing those dangerous substances? Is American
assistance confined to what Nuland described at the hearing — “working
with the Ukrainians on how they can prevent any of those research
materials from falling into the hands of Russian forces” — or did the
U.S. assistance extend to the construction and development of the
“biological research facilities” themselves?
PolitiFact, Feb. 25, 2022.
For
all the dismissive language used over the last two weeks by
self-described “fact-checkers,” it is confirmed that the U.S. has worked
with Ukraine, as recently as last year, in the “development of a
bio-risk management culture; international research partnerships; and
partner capacity for enhanced bio-security, bio-safety, and
bio-surveillance measures.” The U.S. Embassy in Ukraine publicly boasted
of its collaborative work with Ukraine “to consolidate and secure
pathogens and toxins of security concern and to continue to ensure
Ukraine can detect and report outbreaks caused by dangerous pathogens
before they pose security or stability threats.”
This
joint US/Ukraine biological research is, of course, described by the
State Department in the most unthreatening way possible. But that again
prompts the question of why the U.S. would be so gravely concerned about
benign and common research falling into Russian hands. It also seems
very odd, to put it mildly, that Nuland chose to acknowledge and
describe the “facilities” in response to a clear, simple question from Sen. Rubio about whether Ukraine possesses chemical and biological weapons.
If these labs are merely designed to find a cure for cancer or create
safety measures against pathogens, why, in Nuland’s mind, would it have
anything to do with a biological and chemical weapons program in
Ukraine?
The
indisputable reality is that — despite long-standing international
conventions banning development of biological weapons — all large,
powerful countries conduct research that, at the very least, has the
capacity to be converted into biological weapons. The work conducted
under the guise of “defensive research” can, and sometimes is, easily
converted into the banned weapons themselves. Recall that, according to the FBI,
the 2001 anthrax attacks that terrorized the nation came from a U.S.
Army Research scientist, Dr. Bruce Ivins, working at the U.S. Army’s
infectious disease research lab in Fort Detrick, Maryland. The claim was
that the Army was “merely” conducting defensive research to find
vaccines and other protections against weaponized anthrax, but to do so,
the Army had to create highly weaponized anthrax strains, which Ivins then unleashed as a weapon.
A 2011 PBS Frontline program
on those anthrax attacks explained: “in October 2001, Northern Arizona
University microbiologist Dr. Paul Keim identified that the anthrax used
in the attack letters was the Ames strain, a development he described
as ‘chilling’ because that particular strain was developed in U.S.
government laboratories.” Speaking to Frontline in 2011, Dr.
Keim explained why it was so alarming to discover that the U.S. Army had
been cultivating such highly lethal and dangerous strains in its lab,
on U.S. soil:
We
were surprised it was the Ames strain. And it was chilling at the same
time, because the Ames strain is a laboratory strain that had been
developed by the U.S. Army as a vaccine-challenge strain. We knew that
it was highly virulent. In fact, that’s why the Army used it, because it
represented a more potent challenge to vaccines that were being
developed by the U.S. Army. It wasn’t just some random type of anthrax
that you find in nature; it was a laboratory strain, and that was very
significant to us, because that was the first hint that this might
really be a bioterrorism event.
This
lesson about the severe dangers of so-called dual-use research into
biological weapons was re-learned over the last two years as a result of
the COVID pandemic. While the origins of that virus have not yet been
proven with dispositive evidence (though remember, fact-checkers
declared early on that it was definitively established that it came from
species-jumping and that any suggestion of a lab leak was a “conspiracy
theory,” only for the Biden White House in mid-2021 to admit
they did not know the origins and ordered an investigation to determine
whether it came from a lab leak), what is certain is that the Wuhan
Institute of Virology was manipulating various coronavirus strains
to make them more contagious and lethal. The justification was that
doing so is necessary to study how vaccines could be developed, but
regardless of intent, cultivating dangerous biological strains has the
capacity to kill huge numbers of people. All of this illustrates that
research that is classified as “defensive” can easily be converted,
deliberately or otherwise, into extremely destructive biological
weapons.
Foreign Policy, Mar. 2, 2022.
At
the very least, Nuland’s surprising revelation reveals, yet again, just
how heavily involved the U.S. Government is and for years has been in
Ukraine, on the part of Russia’s border which U.S. officials and
scholars from across the spectrum have spent decades warning is the most
sensitive and vulnerable to Moscow. It was Nuland herself, while
working for Hillary Clinton and John Kerry’s State Department under
President Obama, who was heavily involved
in what some call the 2014 revolution and others call the “coup” that
resulted in a change of government in Ukraine from a Moscow-friendly
regime to one far more favorable to the EU and the West. All of this
took place as the Ukrainian energy company Burisma paid $50,000 per
month not to the son of a Ukrainian official but to Joe Biden’s son,
Hunter: a reflection of who wielded real power inside Ukraine.
Nuland
not only worked for both the Obama and Biden State Departments to run
Ukraine policy (and, in many ways, Ukraine itself), but she also was
Vice President Dick Cheney’s deputy national security adviser and then
President Bush’s Ambassador to NATO. She comes from one of America’s most prestigious neocon royal families;
her husband, Robert Kagan, was a co-founder of the notorious neocon
war-mongering group Project for the New American Century, which advocated
regime change in Iraq long before 9/11. It was Kagan, along with
liberal icon Bill Kristol, who (along with current editor-in-chief of The Atlantic Jeffrey Goldberg), was most responsible for the lie that Saddam was working hand-in-hand with Al Qaeda, a lie that played a key role in convincing Americans to believe that Saddam was personally involved in the planning of 9/11.
That
a neocon like Nuland is admired and empowered regardless of the outcome
of elections illustrates how unified and in lockstep the establishment
wings of both parties are when it comes to questions of war, militarism
and foreign policy. Indeed, Nuland’s husband, Robert Kagan, was signaling that neocons would likely support Hillary Clinton for president
— doing so in 2014, long before anyone imagined Trump as her opponent —
based on the recognition that the Democratic Party was now more
hospitable to neocon ideology than the GOP, where Ron Paul and then
Trump’s neo-isolationism was growing.
You
can vote against neocons all you want, but they never go away. The fact
that a member of one of the most powerful neocon families in the U.S.
has been running Ukraine policy for the U.S. for years — having gone
from Dick Cheney to Hillary Clinton and Obama and now to Biden —
underscores how little dissent there is in Washington on such questions.
It is Nuland’s extensive experience in wielding power in Washington
that makes her confession yesterday so startling: it is the sort of
thing people like her lie about and conceal, not admit. But now that she
did admit it, it is crucial that this revelation not be buried and
forgotten.
To
support the independent journalism we are doing here, please subscribe,
obtain a gift subscription for others and/or share the article:
* Hier stond eerder ten onrecht dat Nuland staatssecretairs van defensie is, dit moet politieke zaken zijn, mijn excuus, correctie gedaan op 25 maart 2022, echter men blijft Nuland aanwijzen als staatssecretaris van buitenlandse zaken. (laatste update van 29 mei 2022)
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar de ware grote agressor op onze aarde >> de grootste terreurentiteit ter wereld: de VS zie o.a.:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!!
Voor meer berichten over Syrië, klik op dat label direct onder dit bericht.
Putin heeft in een vraaggesprek met stewards (v/m) belangrijke punten naar voren gebracht over het hoe en waarom van de militaire actie/oorlog tegen Oekraïne. Ik neem aan dat hij dit heeft gedaan daar het werk van velen van hen op een laag pitje staat vanwege de belachelijke sancties, waarmee bijvoorbeeld niet alleen alle Russische sporters worden getroffen* , men het gore lef had zelfs een dirigent te ontslaan, maar ook het platleggen van Russisch vliegverkeer naar het westen….. Overigens geeft men in het westen nu toe dat men ook het gewone Russische volk wil treffen met deze sancties, iets dat men bij andere illegale sancties (niet gesteund met een VN resolutie) altijd ontkende, terwijl door deze sancties, bijvoorbeeld die tegen Irak eind 90er jaren van de vorige eeuw meer dan 500.000 kinderen zijn omgekomen** en de al even illegale sancties van de VS, Canada en de EU tegen Venezuela tot vorig jaar al aan meer dan 100.000 mensen het leven hebben gekost, ook hieronder een groot aantal kinderen…… (in feite werden deze mensen en kinderen vermoord, ook uit onze naam……) Zoals je begrijpt moet het totale aantal doden in Venezuela nu aanmerkelijk hoger liggen…….
In het gesprek met Putin gaf hij in een aantal punten weer waarom Rusland besloot tot de inval in Oekraïne. Zo geeft hij volkomen terecht aan dat de coup van 2014 in Oekraïne een eind maakte aan de democratisch gekozen regering Janoekovytsj en deze staatsgreep werd gefinancierd door de VS met 5 miljard dollar, daar heeft de VS zelfs geen geheim van gemaakt, zonder de VS had deze coup niet plaatsgevonden….. Waarom de VS dat heeft gedaan? Simpel: daar de democratisch gekozen president Janoekovytsj een handelsverdrag met Rusland prefereerde boven dat met de EU en daarmee had deze president het gelijk volkomen aan zijn kant, daar een handelsverdrag met de EU Oekraïne een enorme berg geld zou hebben gekost en een verdrag met Rusland zijn land juist alleen winsten zou hebben opgeleverd….. Echter dat was uiteraard niet de enige reden voor de VS (CIA) om te stoken in Oekraïne: de grens van het land ontbrak nog aan een groot deel van de Russische westgrens waar NAVO troepen zijn gestationeerd en bijna het jaarrond militaire oefeningen houden, oefeningen ook gericht op het binnenvallen van Russisch grondgebied……
Vergeet bij het voorgaande niet dat zogenaamde deskundigen zeggen dat Oekraïne een soeverein land is (wat maar de vraag is, wat zeg ik dat is het land niet!!) en vrij is om zich aan te sluiten bij zowel de NAVO als de EU, terwijl men eerder de democratisch gekozen regering Janoekovytsj de keus voor Rusland heeft ontzegd en dat NB middels een door de VS georganiseerde en betaalde opstand en staatsgreep…….
Verder noemt Putin nog het feit dat Oekraïne 3.000 gekleurde jongeren tegenhoudt van het vluchten uit Oekraïne, een zaak waar ik al een paar keer aandacht aan heb besteed, echter dat het om zoveel jongeren (studenten uit o.a. Afrikaanse landen) ging wist ik niet…..
Ook gaat Putin nogmaals in op de neonazi-controle van Oekraïne, een zaak die uit en te na is bewezen, maar die door het westen als onzin wordt afgedaan, niet voor niets ook dat de reguliere westerse media amper of niet spreken over de gekleurde studenten die worden vastgehouden in Oekraïne en die zoals eerder op deze plek gemeld zelfs uit de trein richting Poolse grens werden getrokken door de Oekraïense politie…….
Al 8 jaar lang worden de burgers van de volksrepublieken Luhans en
Donetsk gebombardeerd door de neonazi-bataljons van het Oekraiense
leger, daarbij zijn volgens Putin naar schatting 13.000 tot 14.000
mensen omgekomen, ofwel die werden vermoord tijdens deze
oorlogsmisdaden, waarbij verder meer dan 500 kinderen omkwamen dan wel (zwaar)
gewond raakten…… Deze volksrepublieken hebben zich van Oekraine afgescheiden nadat de door hen democratisch gekozen president werd afgezet met de coup in 2014. Overigens gaat het hier om dezelfde neonazi-bataljons van het Oekraïense leger die volkomen lak hadden aan de
wapenstilstanden gesloten in Minsk en de daar overeengekomen terugtrekking van zware wapens…….
Men spreekt over de corridors voor vluchtelingen die Rusland toestaat om zo de burgers van steden te laten vluchten, waar deze pogingen keer op keer worden getorpedeerd door neonazi-bataljons als Azov, zoals gezegd behorend tot het Oekraïense leger……. Men wil niet dat de burgers vluchten uit de steden, immers dode burgerslachtoffers ‘doen het goed in het westen’ en vormen bovendien een menselijk schild, daar men weet dat Rusland burgerslachtoffers zoveel mogelijk wil voorkomen…….
Zag bij het zappen op tv twee dagen gelden dat één of andere mafketel de zaak vergeleek met de Russische hulp aan het Syrische bewind tegen ISIS, Al Qaida en andere door de VS, Egypte en Saoedi-Arabië ingevlogen terreurgroepen (vooral uit het door de NAVO naar god gebombardeerde Libië…)…. Men liet zelfs beelden met ingestorte en gebombardeerde gebouwen van Aleppo zien, terwijl het Russische en Syrische leger al 2 maanden voor de totale overname van de stad zijn gestopt met bombarderen, juist om burgerslachtoffers te voorkomen, terwijl ook daar de corridors bewezen onder vuur werden genomen door terreurgroepen…… Juist de terreurgroepen gingen door met het bombarderen van Russische en Syrische stellingen en hadden totaal geen moeite om daarbij hele blokken met appartementen plat te gooien…….. Vergelijk dat met de belegering van steden door de VS in Irak en Syrië, ondanks smeekbedes van de VN heeft de VS steden als Mosul en Raqqa bijna volkomen platgegooid, terwijl daar nog veel burgers aanwezig waren…… (men heeft na de inname grote delen van Mosul zelfs gebuldozerd zonder de lijken eerste te bergen…….)
Nog een toevoeging van10 maart 2022: gisteravond werd er bekend gemaakt dat er wel degelijk jonge dienstplichtigen in Oekraïne zijn en daar zijn omgekomen en gevangen zijn genomen. Dit was geheel tegen de wil van het Kremlin en dat heeft beloofd de verantwoordelijken te zullen straffen (Putin liet in het hierna wergegeven gesprek weten dat er geen dienstplichtigen in Oekraïne zijn)…….
Je zou de video kunnen bekijken met Engelse ondertitels door op cc te klikken, echter dat lukte mij niet (heb het ook met Ctr. c geprobeerd), wel is het gesprek geheel vertaald in het Engels hieronder te lezen, je kan deze tekst vertalen door onder het artikel de Information Clearing House de weergegeven vertaalapp te gebruiken (klik dan op: dutch) of:kopieer de Engelse tekst en plak
die in deze
vertaalapp,
de app werkt snel en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt krijg je een menu te zien waarin je kan kiezen voor Nederlands.
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
Extremely important statements by Putin
(MUST SEE!)
Video and Transcript
March 07, 2022:
Information Clearing House — “Saker ” —As some of you know, Putin spoke at length
with a group of Russian flight attendants.
This is such an important statement that I
asked one of our interpreters (thanks E.!)
to subtitle the video. I am also posting
the transcript below. In this exchange,
Putin spells out in quite some details WHAT
Russia is doing and WHY she is doing it. PS:
please press “cc” to see the English
language captions
My question concerns the current
situation in Ukraine. We all support your
actions and the special operation that is
underway there. Naturally, the most important
question, which, one way or another, all of us
have asked ourselves, is why this special
operation has started. Could it not have been
avoided? Rationally, we do understand and
support your actions, but as women we cannot
help but worry: for our family, relatives, for
those who are in Ukraine. We know that the
civilians are not impacted. But nevertheless,
tell us, reassure us: what are we to expect at
the end of this road? What will be the end
result of the military operation in Ukraine?
I will be brief but still will have to start,
as they say, from “the center of the field”. I
said about this at the start of the operation
and also spoke about this before this decision
has been made, a hard decision, without a doubt.
What is this about? The fact of the matter is
that after the anti-constitutional coup in
Ukraine, which, unfortunately, was strongly
supported by the Western countries – let us face
it. They do not even hide the fact that they
have spent $5 billion on it, not to mention
cookies given away on Maidan, and so on. And
after that, instead of bringing the situation
back on track, even if it had spiraled out of
control, even if it had been the act of the
overzealous locals – there is such legal term,
i.e. planned one thing, but the result turned
out to be something else – they still could
have, and should have, returned the situation
back onto the political track.
Furthermore, shortly before the coup, the
foreign ministers of the three countries came to
Kiev in 2014 and signed an agreement with the
Ukrainian government acting as guarantors of
this agreement to ensure that the situation
would be developing in the political sphere. But
nothing like that occurred. They organized a
coup d’état and supported the perpetrators. What
followed were the well-known events related to
the Crimea and the southeast of Ukraine,
Donbass, where people refused to support the
coup. As we know, the Crimea made a decision;
people came to vote in a referendum to return to
the Russian Federation. Naturally, yes,
naturally, we cannot but support that decision,
al the more so, since they felt they were in
danger from the nationalists and neo-Nazis.
There is strong evidence that they were
absolutely right in that.
Later, or, rather, in parallel, the events in
Donbass were taking place. What have these
events led to? People resisting the results of
the coup were persecuted. Eventually, the new
Kiev authorities initiated a military operation
on that territory. They have conducted two
large-scale punitive operations using of heavy
weapons and combat aviation. They directly
attacked Donetsk destroying the city squares
with aviation, using tanks and artillery. Both
these military campaigns failed. The Ukrainian
army suffered defeat. After that, so-called
Minsk agreements, or the Package of Measures, to
use the official term, have been concluded. The
agreements offered a path for a peaceful
settlement of the conflict.
We did everything we could to direct the
events along this path, to restore the
territorial integrity of Ukraine as well as to
protects the interests of the people living in
these territories. What did these people demand?
Nothing but the basic things: the right to speak
their mother tongue, i.e. the Russian, and
maintain their traditions and culture. These
were by no means extraordinary demands. But no.
These territories were put under economic
blockade; disconnected from the banking system;
the supplies of food were stopped; the payments
of the pensions and social assistance were
suspended. Sometimes, some handouts were given,
but in order to get those pensions and benefits
a person had to cross the separation line.
Now listen. I will now say something that may
sound rough but the situation compels me to say
it. You know that occasionally in some regions
packs of stray dogs attack people, injure or
even kill them (this is a separate problem, and
it is for the local authorities to deal with).
But then these animals are poisoned or shot
dead. But people of Donbass are not stray dogs.
Approximately 13,000-14,000 people have been
killed during these years. Over 500 children
have been killed or injured. But what is
particularly intolerable is that the so-called
“civilized” West has preferred all these years
to look the other way. All these years – 8
years! Eight years!
Moreover, lately the Kiev authorities started
to say openly and publicly that they are not
going to fulfill the Minsk agreements. They are
saying this from the TV screens and online. They
are saying this everywhere on the record: We
don’t like them; we will not do it. And all this
time, Russia has been accused of not fulfilling
the agreements. This is simply nonsense; the
theater of the absurd; white is called black and
black is called white. Lately, things got even
worse. Actually, the talk has started long ago,
but intensified of late. More and more often we
hear that Ukraine would be admitted into NATO.
Do you understand what this could lead to? Or
can lead to still?
If Ukraine is a NATO member, then according
to the North Atlantic Treaty, all other members
must support the country in case of a military
conflict. No one besides us has recognized
Crimea as a Russian territory. The yare
conducting military operations in Donbas but
also could move onto Crimea, and in such case we
would have to fight with the whole of NATO. What
is that? Do you understand the consequences? I
think everyone understands.
Now they (Ukraine) are talking about
acquiring the nuclear status, i.e. developing
nuclear weapons. We cannot possibly ignore such
things, particularly considering that we know
how the so-called West behaves with regard to
Russia. First, Ukraine has some nuclear
competence left from the Soviet time. As far as
enrichment and nuclear material are concerned,
they would be able to organize that work. They
have missile abilities: suffice is to mention
Yuzhmush. This company used to build
intercontinental ballistic missile equipment for
the Soviet Union. They could recover that
ability and do it. And those from across the
ocean would even help them do it. And after that
would say: “Well, we do not recognize the
nuclear status; they have done everything
themselves”. And then they would put these
complexes under control, and from that moment
on, from that very second, the fate of Russia
will be completely different. Because in that
case, our strategic adversaries would not even
need intercontinental ballistic missiles. They
would keep us right here at the nuclear
gunpoint, that is all. How could we disregard
such a thing? These are absolutely real threats,
not some far-fetched silly fantasy.
Our boys who are now fighting and risking
their lives, they are fighting and giving their
lives for our future, for the future of our
children. This is something perfectly obvious.
And the people who do not want to understand
that, particularly those among today’s leaders
(of Ukraine), have to understand that if they
keep doing what the have been doing – I have
spoken about this before – they put at risk the
very future of the Ukrainian statehood. If this
happens, that will be entirely their fault.
What is going on now? I have already
mentioned our objectives in this operation.
First, of course, is to protect the people
living in Donbass. How? By demilitarizing and
denazifying Ukraine as well as establishing its
neutral status. Why? Because the neutral status
means Ukraine will not be joining NATO. They
have it written in the Constitution that the
country will be joining NATO. You understand –
they have included that into the Constitution!
Denazification – what does this mean? I have
spoken with my Western colleagues about this.
They say:” What is the problem? You also have
the radical nationalists”. Yes, we do. But we do
not have them in the government, but everybody
agrees that they (the Ukrainians) do. Perhaps,
we have some idiots running around with
swastika, but do we support that at the
government level? Do thousands of people march
with torches and swastikas on the streets of our
capital or other cities in Russia, like it
happened in 1930s in Nazi Germany? Is something
like that happening in Russia? But it happens in
Ukraine, and it is supported. Do we support
those who killed the Russians, Jews, or the
Poles during the war? Do we hail them as heroes?
But in Ukraine, they do.
The current events are also very important.
Look, the foreign citizens have been taken
hostages in Sumy and Kharkov – over 6,000 young
people, students. They have been driven together
into a railway station and kept there for 3
days. Listen, they have been held there for the
third day. We have told everybody about this and
informed the current Ukrainian authorities. They
said: “Yes, yes, of course, we will deal this
this right now”. We have informed the leaders of
the major European countries, I personally
talked to them. “Yes, yes, we will put pressure
on Ukraine right now”. We informed the UN
Secretary-General: “Yes, yes, we will solve the
problem right away”. Nobody is doing anything.
People who are considered the citizens of
Ukraine are treated even worse. They are simply
used as a human shield. Right now, in this very
moment, this is happening in Mariupol. The Kiev
government called our military: ”Provide
humanitarian corridors so people could leave”.
Naturally, our people instantly responded, even
suspended the military activities, and were
observing what was happening. But no one was
allowed to leave. You understand, no one was
allowed out. They do not anybody leave but
instead use the people as a human shield. Who
are they? The neo-Nazis, of course.
We already observe the presence of the
militants from the Middle East and some European
countries. We know about them; we can hear them
speak on the radio. They are using so-called
jihad-mobiles, i.e. cars stuffed with
explosives, which they drive towards the Russian
troops. But they do not achieve anything, and
they will fail in the end. Who are they, then,
if not neo-Nazis? By such actions, they are
destroying their own country and their own
statehood.
That is why one of our key demands is
demilitarization. In other words, we are helping
people of Donbass by working towards the neutral
status of Ukraine and the demilitarization of
the country. We have to know with certainty what
weapons are there, where they are deployed, and
who controls them. A number of options are on
the table. We are discussing them now, including
with the Kiev government representatives in our
talks in Belarus. We are grateful to the
President Lukashenko for organizing the meetings
and helping us to conduct these negotiations.
Our proposals are on the table for the groups of
the negotiators from Kiev to study. We hope that
Kiev will respond positively to our proposals.
This is pretty much all I wanted to say.
Please, let us continue.
Schvidko, Yulia, the second pilot of the
Aeroflot airline. Vladimir Vladimirovich, good
afternoon. My question is about the current
situation. Many rumors are circulating about
possible introduction of the marshal law,
drafting of volunteers and reservists, and that
the draftees will be sent to Ukraine. Could you
clarify whether the marshal law will be declared
and whether the drafted soldiers will be
deployed to Ukraine.
Many of what we now see and what is happening
is undoubtedly a technique to fight against
Russia. By the way, the sanctions imposed today
are close to a declaration of a war. But
fortunately, we are not there yet. I believe
that our so-called “partners” still retain some
understanding of what a war would mean and what
danger it presents for everybody. That is
despite that irresponsible statements, such as
made by the British Foreign Minister, when she
blurted that NATO could involve itself in the
conflict. At that point, we had to immediately
make a decision to put our strategic forces on
high alert. They reacted by saying that they did
not mean anything of the sort. However, nobody
put the Minister in her place, and nobody
disavowed her statement. No one said anything to
us about that statement, like it was her
personal opinion, do not pay attention, or
something like that. Nothing. What are we
supposed to think about that? That is why we
reacted the way we did.
Now about your question. The marshal law is
introduced by the order of the President
supported by the Federation Council in the case
of the external aggression, specifically in the
regions where the military activity takes place.
We are not in that situation now, and I hope
will not be. This is first. The second point –
there is also, in addition to the marshal law, a
special status. This status is also declared by
the Federation Council in case of a significant
internal threat. The third regime is the state
of emergency, which is usually declared in
particular regions, although could also be
adopted in the entire territory of the country.
This regime is for technological and natural
disasters. Thanks God, this is also not
happening. We are not planning to declare any of
these regimes on the territory of the Russian
Federation. There is no need for that today.
We can see that attempts are being made to
stir up trouble in our society, which is again a
conformation of my words that we are dealing
with not just the radicals but with the
neo-Nazis. Here people are expressing their
opinion about what they like or dislike in our
action in Ukraine. But there, in Ukraine, people
that express the opinions similar to those
expressed by the so-called ‘liberal” part of our
society, are being detained on the streets and
shot – we do have confirmation of that. Our
special services are now collecting this
information and we will be presenting it soon.
Our liberal intellectuals are protesting,
whereas in Ukraine people that say anything in
favor of Russia are been executed without trial.
I repeat, that the marshal law is declared in
case of the external aggression, which I hope
will not happen despite irresponsible statements
of some officials. We hear that a no fly zone
should be established over the Ukrainian
territory. This is impossible to do in the
territory of Ukraine itself; this is only
possible to organize from the territories of the
neighboring countries. However, we will consider
any movement in this direction as active
participation in the military conflict by a
country, the territory of which is used to
create danger for our servicemen. We will in a
second consider them as a party to the military
conflict. I hope this is also understood, and it
will not come to that.
Only professional military personnel are
taking part in this operation, officers and
contract servicemen. Not a single drafted
soldier is participating, and we are not
planning to send them to Ukraine, and we will
not. I repeat only men who have made a voluntary
responsible decision in their lives – to defend
their country – are in Ukraine, and they are
doing their duty with honor. Why this is the
case, why we have the right to say these words,
I have just explained to you. This also applied
to reserve personnel undergoing periodic
military training – we are not planning to
deploy them to Ukraine. They are summoned to the
military training on the regular basis – this
happens now and will be happening in the future
– but we will not enlist these people for the
active military service, and they will not
participate in this conflict. We have sufficient
resources to achieve our objectives employing
only our professional army.
I would like to comment on the military
operation itself. I know many rumors and stories
are being circulating. I do not have much time
to learn about this, but I have been informed
that people talk a lot about what is happening
and how the operation is proceeding. All
analysts know what is going on, so I am not
going to reveal any secrets here. We could have
acted in many different ways. We could have
helped the Donbass republics directly on the
separation line, i.e. on the front, using our
Russian army to support them. But in such case,
considering the unconditional support by the
West of the radical nationalists, the Ukrainian
side would have received constant support by
weapons, material, ammunition, and all.
That is why our General Staff and the
Ministry of Defense decided on a different
strategy. First that was done is the elimination
of the military infrastructure. Not entirely,
but largely. The weapon depots, ammunition
depots, aviation, air defense systems. The
destruction of the air defense systems requires
certain time. You are civilians but you do work
in aviation. You understand that these systems
need to be uncovered and then destroyed; by now
this work is largely done. That is what brings
about the demands for a no fly zone. However, an
attempt to put this into effect would lead to
enormous and catastrophic consequences not only
for Europe, but also for the entire world. I do
believe that the people on the other side do
understand that. That is why we have chosen this
path, correctly, as it turned out. Our military
is working responsibly doing everything possible
to protect the civilians. Unfortunately, those
neo-Nazi bandits do not have any consideration
for the people. They even shoot their own
servicemen who do not want to continue fighting
– we do have evidence of that. Yes, those
nationalists, neo-Nazis shoot their own
servicemen. The nationalists are embedded in
practically every Ukrainian military unit,
several dozens of them in each, and they act in
such a cruel way.
I repeat one more time: we will not deploy
draftees or reservists to Ukraine to participate
in this military operation. I am convinced that
our army will achieve all our objectives. I do
not doubt that for a second. This is evident
from the way the operation is proceeding, which
is strictly according to the plan, to the
schedule; all is happening the way it had been
planned by the General Staff. Oh, regarding
volunteers, the young people who come to the
recruiting stations – we are grateful to them
for their patriotic sentiments, the desire to
support their country and its army in this time.
The very fact that they come is significant.
However, their help is not required at this
time. And I am convinced will not be needed. Now
I am turning towards the camera. They will see
me and hear what I am saying – thank you.
French,
translation- Note-
Translation may take a moment to load.
=====================================
* Terwijl men bij organiseren van wedstrijden in de
vreselijkste dictaturen altijd stelde dat sport niets met politiek heeft
te maken en dit jaar het WK Voetbal in Qatar wel gewoon doorgaat, ondanks dat voor de bouw van de stadions al meer dan 6.000 slaven onder erbarmelijke omstandigheden zijn omgekomen….. (ook hier moet je spreken over moord!!) Het is zelfs zo zot dat Ajax en PSV regematig trainen in Qatar, terwijl deze ploegen wel een grote bek hebben over de Russische inval in Oekraïne >> kortom deze voetbalclubs zijn totaal ongeloofwaardig!!!
** De hoofdverantwoordelijken destijds: viespeukpresident en oorlogsmisdadiger Bill Clinton en zijn minister van BuZa, hare kwaadaardigheid Madeleine Albright, deze oorlogshoer heeft jaren later nog eens laten weten dat ze geen moeite had met de dood van die 500.000 Irakese kinderen >> beiden hadden al lang en breed voor de rest van hun leven in de gevangenis moeten zitten na een veroordeling van het Internationaal Strafhof (ICC)…… Nu durft het ICC wel onderzoek te doen naar eventuele oorlogsmisdaden van Rusland, terwijl het jaren wegkeek toen de neonazibataljons de burgers van de afgescheiden staatjes Luhansk en Donetsk vermoordden…… De VS durft men al helemaal niet meer te onderzoeken op oorlogsmisdaden, daar de rechters en anderen van het ICC die zich daarmee bezig zouden houden, op de zwarte lijst van de VS komen……..
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar berichten over de oneindige VS terreur:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!!
Donderde vanmorgen met een klap uit m’n stoel toen ik een PvdA verkiezingsspotje op de radio hoorde. De spot werd ingesproken door hare kwaadaardigheid Ploumen, die als minister van Ontwikkelingssamenwerking in het kabinet Rutte 2 een groot aantal succesvolle ontwikkelingsprojecten de nek omdraaide en het geld daarvoor aan Nederlandse ondernemers in ontwikkelingslanden heeft gegeven, die volgens deze (er toen als mislukte hippie uitziende) sufferd beter hulp konden bieden….. Twee jaar later maakte een rapport van Oxfam Novib gehakt van deze zogenaamde hulp: de ondernemers hadden het geld in hun zak gestoken en er gebeurde zo goed als niets meer op het gebied van ontwikkelingssamenwerking…….
De PvdA heeft al van voor deze naamgeving ervoor gepast zich socialistisch te noemen, dat was vloeken in de PvdA kerk, dat erop bleef hameren een sociaaldemocratische partij te zijn. Nu durft Ploumen in het spotje voor de gemeenteraadsverkiezingen te beweren dat je PvdA moet stemmen voor een socialer beleid……. ha! ha! ha! ha! ha! ha! Het socialisme begint weer een beetje hip te worden en dat misbruikt Ploumen voor deze smerige verkiezingsleugen…….
Ploumen met alweer een nieuw uiterlijk >> logisch men moet zich vooral de eerdere blunders van deze disfunctionerende politicus* niet herinneren…. Waar Ollongren met een klein stapeltje papieren rondliep (waarop de voorgestelde functie voor Omtzigt was te zien), doet Ploumen of ze keihard werkt, met een dikke ordner en een handtas….. ha! ha! ha! ha! (zo te zien is ze ook zwanger van nog een ordner)
Hier de tekst op de PvdA site voor de gemeenteraadsverkiezingen:
Het moet socialer in Nederland, zodat we ons allemaal thuis voelen.
Want
wat is nu echt belangrijk? Dat we de woningnood oplossen en dat er een
betaalbaar huis is voor iedereen. In een fijne buurt. Waar minder
verdeeldheid is en waar we naar elkaar omzien. Samen gaat ons dat
lukken. Hier vind je de plannen van de PvdA bij jou in de buurt. Vul
hier de gemeente in waar jij woont, en kijk welke plannen de PvdA heeft.
Socialer is dat het beleid van de PvdA in Rutte 2?? Je weet wel ondanks de bankencrisis werden toen jaar in jaar uit de huren onbeschoft verhoogden dat zogenaamd vanwege de kostenstijging een jaar eerder, terwijl de politici van de PvdA dondersgoed wisten dat de grootste kostenstijging jaar op jaar meestal de huurverhoging is…… Ofwel ook destijds werden de huurders dubbel gepakt door de neoliberale ploerten van de PvdA….. Om nog maar te zwijgen over het akkoord gaan van de PvdA met de verkoop van sociale huurwoningen aan investeerders vooral uit het buitenland en het meedoen van deze partij aan het slopen van sociale huurwoningen, om daar peperdure huurwoningen voor terug te bouwen…. Daarnaast was de PvdA akkoord met de grote diefstal van de huurders middels de verhuurdersbelasting, waardoor vele blokken sociale huurwoningen nog wachten op isolatie…… Verder deden PvdA wethouders als die van andere partijen of ze grondspeculanten waren en verkochten de grond voor een prijs alsof deze boven een goudmijn lag, wat uiteraard mee heeft geholpen de huizenprijs naar ongekende hoogten te brengen…… (een hoogte die ervoor zorgt dat men het gelegitimeerd vond en vindt om de huren nog verder te verhogen…..) De PvdA is bovendien verantwoordelijk voor het bouwen van een groot aantal parkeergarages in bijvoorbeeld de buurt van het Haagse centrum, zodat de bewoners extra worden ‘vergast’ door bezoekers aan dat centrum……. (onder de kabinetten Rutte 2 en 3 zijn er 100.000 sociale huurwoningen verdwenen en dan durfden de politici van de deelnemende partijen als de PvdA nog onbeschoft over scheefwoners te spreken…..)
Socialer zoals het sluiten van sociale werkplaatsen en het met subsidie herplaatsen van mensen uit die sector in het bedrijfsleven, buiten dat velen van hen geen werk meer hadden (en kregen) waren veel van degenen die wel in bedrijven werden geplaatst doodongelukkig…….
Het voorgaande bestaat nog maar uit een paar zaken die aantonen dat de PvdA allesbehalve sociaal is, maar zich als regeringspartij keer op keer ontpopt als inhumane neoliberale partij….. Daar de PvdA fiks is achteruitgegaan in het aantal stemmen, gooit men het nu weer op een ‘socialer Nederland’, wie dit nog gelooft is ofwel lid van deze waardeloze partij, ofwel is stekeblind en stokdoof!!!
Overigens alle nieuwlichters van de PvdA in de Tweede Kamer zijn van e.e.a. op de hoogte, juist daar het gros van hen eerst lid is geweest van de ‘Jonge Socialisten…’ ha! ha! ha! ha! ha! ha! ha! Ofwel deze nieuwlichters zijn al oplichters als ze in de Kamer zitting mogen nemen!!!
Het sociaaldemocratisch gehalte van de PvdA was al een lachertje, zeker zoals gezegd als de partij weer eens meeregeert en de partij zich in die regeerperiodes weer laat zien als een inhumane neoliberale (rot-) partij…… Zo heeft de PvdA hard meegewerkt aan het bezuinigen op de zorg, waardoor ziekenhuizen verdwenen daar de peperdure zorgverzekeraars deze te duur vonden, NB de hoofdreden waarom het kabinet Rutte 3 met de Coronahysterie onze burger- en grondrechten zwaar geweld aandeed (en nog doet, we zijn er nog lang niet als het om het virus gaat), immers men had te weinig IC bedden en verpleegkundigen……
Bovendien werd Rutte 2 in 2016 door de AIVD en MIVD gewaarschuwd voor het feit dat Nederland niet klaar was voor een pandemie en weet je wat de belangrijkste reden voor die waarschuwing was? Juist: het grote tekort aan IC bedden, verpleegkundigen voor die bedden en intensivisten…… In plaats van direct maatregelen te nemen zijn de kabinetten Rutte 2 en 3 daarna gewoon doorgegaan met het bezuinigen op de zorg, inclusief het verder sluiten van ziekenhuizen en daarmee werd het tekort aan verpleegkundigen verder vergroot….. Met het voorgaande kan je dan ook stellen dat Ploumen mede verantwoordelijk is voor de meer dan belachelijke Coronamaatregelen…… Vergeet verder niet dat er een aantal verpleegkundigen is overleden aan het vermaledijde virus, puur en alleen omdat ze zwaar overwerkt waren (te weinig personeel) en zoals je waarschijnlijk wel weet is dat een aanslag op je immuunsysteem >> ofwel alle partijen vanaf de kabinetten Rutte 1 tot en met nu Rutte 4 zijn ook nog eens verantwoordelijk voor de dood van verpleegkundigen (Rutte 4 is daar ook al verantwoordelijk voor, immers dat afbraakkabinet bestaat uit dezelfde flutpartijen als Rutte 3 en daarnaast heeft dat kabinet aangegeven nog meer op de zorg te willen bezuinigen, waar de partijen van Rutte 3 vorig jaar tegen uitbreiding van het aantal IC bedden hebben gestemd…..)
Bij het aantreden van Rutte 1 hadden we 2.200 IC bedden, bij het uitbreken van het Coronavirus waren er daar nog 1.100 van over…… ‘Echt iets om trots op te zijn’, hè Ploumen??!!!
Vergeet ik bijna te vermelden dat de PvdA niets heeft gedaan aan het schandalig lage minimumloon, zowel onder de kabinetten Balkenende 4 als Rutte 2 >> PvdA: Partij van de Arbeid…… Beter gezegd: Partij van zo laag mogelijk betaalde Arbeid!!
PvdA stemmen? Denk nog eens na en gebruik je verstand, zeker als je net modaal of daaronder verdient ben je bij de PvdA aan het verkeerde adres!!!
Nederland zonder de PvdA, zodat iedereen zich echt thuis kan voelen!!
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
* Ik ben gestopt met vrouwelijke aanduidingen te gebruiken, dat leidt alleen maar tot achterstelling van vrouwen, iets waar we anno 2022 eindelijk voorgoed vanaf moeten!! (het is overigens Internationale Vrouwendag, ofwel gefeliciteerd vrouwen, nu nog echte gelijkheid voor jullie!!)
Voor meer berichten over de blunders van Ploumen en/of de PvdA, dan wel over het Coronavirus en/of de huurstijging, klik op het betreffende label, direct onder dit bericht.
Vorige week heeft de aartsbisschop van Keulen, kardinaal Rainer Maria Woelki laten weten dat hij zijn functie wil neerleggen, daarover moet het Vaticaan en m.n. hufter Bergoglio, alias paus Franciscus, nog een beslissing nemen.
Woelkie kwam in opspraak toen hij in 2020 een rapport onder tafel wilde houden waarin 200 r.k. ‘geestelijken’ werden aangeklaagd voor seksueel misbruik van kinderen vanaf begin 70er jaren van de vorige eeuw waarbij het om tenminste 300 slachtoffers zou gaan…… (maar reken gerust dat het werkelijke aantal veel hoger ligt…..)
In 2021 kon Woelkie een vervolg onderzoek niet tegenhouden en daarin worden zelfs naaste medewerkers van Woelkie genoemd, terwijl deze ploert zelf uit de wind werd gehouden…….
Woelkie ging na grote ophef in de media en onder het kerkvolk een half jaar op ‘geestelijk bezinningsverlof’, terwijl de Keulse katholieke kerkgemeente Woelkie niet meer wenste te zien, echter Paus Franciscus vond dat Woelkie niets viel te verwijten en gelastte deze weer aan het werk te gaan, echter als eerder gezien, rekende Franciscus buiten de kerkgemeente en die wenste Woelkie niet langer te zien.
‘Gott begleited uns’ >> maar de misbruikte kinderen kunnen barsten………
Daarop besloot Woelki ziin functie neer te leggen. Nu is het dus weer wachten op Franciscus en diens toestemming tot vertrek van Woelkie, dan wel dat hij hem nogmaals gelast weer te gaan werken…….. (het was al uitermate onbeschoft van Franciscus dat hij Woelki weer wilde laten ‘werken’, daar het overduidelijk was dat de meerderheid van de Keulse kerkgemeente deze schoft niet meer wenste te zien…….)
Vergeet bij dit alles niet dat de rk top, dus inclusief Franciscus, niet alleen decennia hebben weggekeken van kindermisbruik door rk geestelijken, maar dat diezelfde top ook verantwoordelijk is voor een enorme massamoord die zich nog steeds voltrekt: het verbod op anticonceptie, waardoor jaarlijks nog steeds meer dan 100.000 mensen overlijden aan aids, het laatste cijfer over 2020 spreekt over 150.000 aids doden……. Om nog maar te zwijgen over het verbod op abortus waardoor in voor het grootste deel rk landen jaarlijks een groot aantal vrouwen overlijden tijdens de bevalling…… Franciscus had het gore lef om vrouwen die een abortus hebben ondergaan te beschuldigen van huurmoord……. (hoe knettergek kan een paus in z’n bol zijn!!)
Oh ja, mijn excuus aan de wolven voor de vergelijking van hen met de conservatieve, achterbakse, massamoordenaar Franciscus……..
Hoorde zojuist op WDR 5 dat de aartsbisschoppen van Duitsland overleg hebben over het wantrouwen van de rk gelovigen in de top van de rk kerk, daarbij o.a. aandacht voor het lakse gedrag van de voormalige paus Rrrratzinger, ofwel Benedictus XVI en ook daar ging het om grootschalig kindermisbruik door de rk kerk……… Zie wat dat betreft: ‘Paus Ratzinger alias Benedictus XVI heeft keihard gelogen, Duise katholieken woedend‘ Snap werkelijk niet dat er nog mensen zijn die de rk kerk bezoeken na alle kindermisbruik ellende…..
Een paar dagen geleden schreef ik al over gekleurde jongeren die studeren in Oekraïne en die het vluchten uit dat land onmogelijk wordt gemaakt* door de douane van o.a. Polen, hetzelfde Canadese radiostation die dit (voor mij) als eerste meldde was CBC Radio1. Dezelfde zender bracht een dag later het neuws dat het deze gekleurde studenten zelfs al in Kiev en andere Oekraïense steden onmogelijk wordt gemaakt te vluchten met de trein, de Oekraïense politie sleepte deze mensen zelfs uit de trein, waar sommigen van hen meer dan 24 uur hadden gewacht op een plaats richting grens, een aantal van deze studenten durfden het aan om dit te verklaren voor de microfoon (anderen waren bang dat hen dit nog meer ellende zou bezorgen…..)…….
Weet niet hoe jij hierover denkt, maar wat mij betreft is dit een teken dat de Oekraïense overheid racistisch en daarmee fascistisch handelt……. In het westen wordt met de grote propagandawals die over de volkeren is en wordt uitgerold, gesteld dat het onzinnig is om te stellen dat Oekraïne wordt geregeerd door neonazi’s, terwijl de bewijzen daarvoor overweldigend zijn en daarbij is het voorgaande nog maar één van de opvallende punten die dit in feite bevestigen……
De VS kocht de opstand en staatsgreep tegen Janoekovytsj, de voormalig democratisch gekozen president van Oekraïne, met 4 miljard dollar, officieel houdt men dat bedrag op 5 miljard dollar, maar ik blijf liever ‘aan de voorzichtige kant’ (beetje suf: alsof 4 miljard kattenpis is)….. Een bedrag dat oorlogsmisdadiger Killary Clinton vrijmaakte voor haar aftreden als minister van buitenlandse zaken onder de al even schuldige oorlogsmisdadiger Obama en dat om in Oekraïne een VS gezinde juntaleider te parachuteren….. Ook de moordenaars die op het Maidanplein in Kiev burgers en politieagenten doodschoten werden ingehuurd door de VS (CIA), dat verder gebruik maakte van de goed georganiseerde neonazi-groepen in Oekraïne, waar de VS deze schoften verder bewapende en trainde……
Na de coup tegen de democratisch gekozen president Janoekovytsj, parachuteerde de VS de zwaar corrupte neonazi Porosjenko als ‘interim president’ (lees: juntaleider)….. Zijn zogenaamde regering werd gecontroleerd door neonazí’s die bovendien begonnen met het gewelddadig intimideren en zelfs vermoorden van lastige journalisten en echte politieke oppositie zo goed als onmogelijk maakten, wat des te meer geldt voor oppositie die voortkomt uit de etnisch Russische bevolking van Oekraïne….Voor verkiezingen wordt het kritische oppositie, ook die bestaande uit mensen die oorspronkelijk uit Rusland komen, het werken zo goed als onmogelijk gemaakt, niet vreemd dan ook dat je hiermee kan stellen dat Oekraïne geen soevereine democratische staat is, maar een staat die onderhands in feite wordt bestuurd door de VS en neonazi’s…….. (overigens het samenwerken van de VS met fascisten en het steunen van deze inhumane schoften kent een lange geschiedenis, zelfs al van ver voor de Tweede Wereldoorlog >> WOII…..)
Etnische Russen in Oekraïne werden al voor de inval van Rusland belaagd door
o.a.neonazi-groepen en dan heb ik het niet over deze mensen in de
volksrepublieken Donetsk en Luhansk, die worden al vanaf 2014 aangevallen door neonazi-bataljons en wel zo dat veel van deze mensen al jaren
geleden zijn gevlucht en worden opgevangen in Rusland, wat de laatste
maanden al helemaal in een stroomversnelling is geraakt….. Gezien de enorme hysterie in de reguliere westerse media over de inval van Rusland en alles wat men daarbij haalt, is het uitermate vreemd dat het voorgaande zonder enige belangstelling van die media kon gebeuren….. Nee, de westerse media gaan zelfs zover dat ze keihard liegen dat de etnische Russen (die overigens voor het grootste deel al generaties lang in Oekraïne wonen) de Oekraïense troepen aanvallen, terwijl die troepen (zoals gezegd vooral bestaand uit neonazi-bataljons), niet anders doen dat steden en dorpen bombarderen in de afgescheiden staatjes Luhansk en Donetsk en ja als die neonazi’s bezig zijn met bombardementen kunnen ze worden aangevallen door bewapende militairen uit die afgescheiden staatjes, militairen die na de coup in 2014 uit het Oekraïense leger stapten en daarbij grote hoeveelheden wapens, munitie en zelfs tanks hebben buitgemaakt…….
In het hieronder opgenomen artikel van Caitlin Johnstone stelt ze o.a. volkomen terecht dat wanneer het westen in deze gelijk zou hebben (dus ook de grote propagandatour die de media hebben ingezet na de Russische inval) er geen reden zou zijn om censuur uit te oefenen op mensen of alternatieve mediaplatforms die anders tegen deze zaak aankijken…… Ofwel wie de waarheid in pacht heeft heeft niets te vrezen van figuren die de waarheid geweld aandoen, nog weer anders gezegd: het westen weet dondersgoed dat haar bevolking op een ongelofelijke manier manipuleert met valse propaganda……. Censuur hoort bovendien niet thuis in een ‘democratie’, laat staan dat je vrijheid en democratie zou moeten beschermen met het uitoefenen van censuur (een contradictio in terminis) en het continu brengen van anti-Russische propaganda zonder ook maar een flinter aan begrip op te kunnen brengen voor de situatie van dat land, te schunnig voor woorden!!!
Voorts is het volkomen belachelijk dat het westen met de VS voorop keer op keer liet weten te willen praten met Rusland, terwijl men niets, maar dan ook helemaal niets wilde toegeven en Rusland eisen oplegde die het land volkomen terecht weigerde….. Zoals al vaker gesteld op deze plek: hoe lang kan je een wereldmacht tarten voordat deze ingrijpt…… Rusland heeft alle recht om bang te zijn voor de VS en haar NAVO-partners die bijna het jaarrond militaire oefeningen houden langs haar westgrens, dit nog naast het zogenaamde raketschild van de VS in Polen en Roemenië, een schild tegen inkomende raketten uit Iran (ha! ha! ha!), maar die in zeer korte tijd kunnen worden uitgerust met meerdere aanwezige kernkoppen en daarmee het door de VS opgezegde INF-verdrag schenden en grote Russische steden kunnen vernietigen…….. (de VS heeft dat verdrag opgezegd onder de fascistische psychopaat Trump, daar Rusland raketten zou hebben ontwikkeld die niet voldoen aan de afstanden in dat verdrag >> het raken van doelen binnen 500 tot 5.500 kilometer, echter op uitnodigingen van Rusland om deze raketten te inspecteren en zo te kunnen zien dat ze het verdrag niet schenden, heeft de VS keer op keer negatief gereageerd……)
Tel bij het voorgaande op dat zowel de VS als Groot-Brittannië al onder resp.Obama (en zijn vicepresident Biden!!) en premier May hebben laten weten het kernwapen niet langer te zien als afschrikkingswapen, maar als eerste aanvalswapen en je begrijpt dat Rusland alle reden heeft om verdere militarisering door NAVO troepen aan de andere kant van haar westgrens te willen voorkomen…… De NAVO, altijd onder militair opperbevel van de VS, zegt een verdedigingsorganisatie te zijn en Rusland dus niets te vrezen heeft, een leugen van ongekend formaat als je ziet hoeveel oorlogsmisdaden deze organisatie alleen deze eeuw al heeft begaan in landen als Afghanistan, Irak, Libië en Syrië……. De VS en haar NAVO-partners zijn deze eeuw dan ook verantwoordelijk voor meer dan 5 miljoen moorden begaan in illegale oorlogen waarbij vergeleken het gebruikte geweld bij de Russische inval in Oekraïne kinderspel is…….
Nogmaals: de VS en haar NAVO-partners zijn geheel verantwoordelijk voor de actie die Rusland heeft ondernomen!! Terwijl oorlogshitsers en hersenlozen intussen schreeuwen om een ‘no fly zone’ boven Oekraïne, alsof dat land geen luchtmacht heeft en alsof dit niet direct tot de Derde Wereldoorlog (WOIII) zal leiden, een oorlog die het grootste deel van de mensheid zal wegvagen……. (vergelijk dat eens met de Gazastrook, waar de Palestijnen zowel daar als op de West Bank geen luchtmacht hebben en Israel keer op keer de openluchtgevangenis Gazastrook bombardeert >> geen westers land en hun ‘onafhankelijke’ media die een woord vuil hebben gemaakt om een ‘no fly zone’ boven de Gazastrook te eisen, terwijl het geweld van Israël tegen het verdrukte Palestijnse volk daar ook heel wat verder gaat dan het geweld dat Rusland in Oekraïne gebruikt…..)
Tot slot wordt ik doodziek van figuren die durven te zeggen dat het voor het eerst sinds WOII oorlog is in Europa, waarbij men de oorlog in voormalig Joegoslavië voor het gemak even vergeet, alleen om de eigen woorden kracht bij te zetten….. Overigens werd die oorlog voor een groot deel veroorzaakt door het westen, niet in de laatste plaats door Genscher, de voormalig minister van buitenlandse zaken van Duitsland (onder fascist Kohl), die Kroatië en Slovenië aanzette zich af te scheiden van Joegoslavië, omdat daar o.a. Duitse autofabrieken stonden….. (en welllicht nog staan)
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
(als
je het Engels niet machtig bent, kopieer dan de Engelse tekst en plak
die in deze
vertaalapp,
de app werkt snel en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt kan je kiezen voor Nederlands)
We’re
risking a very fast, very radioactive World War 3 to defend the
“democracy” of a nation whose government bans opposition parties,
imprisons political opponents, shuts down opposition media, and takes
all its orders from Washington due to a US-backed coup in 2014.
“Defending Ukrainian democracy” makes as much sense as “Defending Mongolian seaports”.
❖
The
powers responsible for destroying Iraq, Afghanistan, Libya, Syria and
Yemen are the same powers we’re trusting to carefully navigate extremely
delicate nuclear brinkmanship escalations without ending the world.
“Relax,
nobody’s gonna start a nuclear war” is a belief that is premised upon
the assumption that the empire which laid waste those nations, while
destroying our environment and making everyone crazy and miserable, is
competent enough to walk that precarious and unpredictable tightrope.
❖
I keep getting comments like “You’re saying we just can’t strike Russia AT ALL, just because they have nukes??”
Yes.
Fucking duh. What are you an idiot? What the fuck is wrong with people?
Did everyone forget what nuclear weapons are? Did schools stop teaching
this or something?
❖
Caitlin Johnstone
@caitoz
It’s getting so very creepy how aggressively anything besides the US/NATO narrative gets stomped down and how okay everyone is with it. You don’t have to agree with the other side to see it as plainly destructive for it to be forcefully shut down all across the media spectrum.
Caldron Pool
@CaldronPool
Stan Grant kicks an Australian-Russian man out of #QandA for questioning the media’s pro-Ukraine/anti-Russia coverage.
You
can’t fix a problem you don’t understand. And right now with Ukraine
the entire western political/media class is pouring a tremendous amount
of energy into keeping people from understanding the problem.
❖
If they were telling us the truth about Russia they wouldn’t be censoring Russian media.
❖
Kinda odd how defending freedom and democracy requires such copious amounts of censorship.
❖
Don’t
worry, I’m sure all those socialist and antiwar Americans that were
platformed by RT America can just get jobs criticizing the murderousness
and corruption of their government in the free press of the western
mainstream media.
❖
I wonder if we should be concerned that the entire western world is propagandizing and censoring like it’s on war footing?
❖
Socialists and anti-imperialists should never
accept platforms on Russian media to get heard. They should wait until a
respectable western mainstream outlet agrees to platform them, and keep
waiting, and waiting, and just keep on waiting until we all die in a
nuclear holocaust.
❖
People tend to overestimate the power of the US war machine and underestimate the power of the US propaganda machine.
❖
Caitlin Johnstone ⏳@caitozI wonder who put the idea in Zelensky’s head that western powers might use military force to defend Ukraine in this war they talked him into fighting? Must be stressful learning your imperial buddies never saw you as anything other than a sacrificial pawn on the grand chessboard.Quote TweetNatasha Bertrand@NatashaBertrand · Mar 4New: Zelensky in late night address tonight slams NATO over ruling out no-fly zone. “This is the self-hypnosis of those who are weak, insecure inside, despite the fact they possess weapons many times stronger than we have,” he said.Show this thread12:26 AM · Mar 5, 2022·Twitter Web App451 Retweets29 Quote Tweets1,540 Likes
❖
Remember
when US officials kept saying “We’re not trying to start a war, we’re
trying to prevent one” while refusing to make reasonable low-cost
concessions that would have prevented a war, then, when war started,
launched operations which serve the long-term goals of US hegemony?
Russia
gets control of Kyiv with this war, while the US gets international
consensus for unprecedented economic warfare and support for NATO, plus
giving Moscow another Afghanistan. NATO powers could have prevented this
war but chose to egg it on instead. Looks like a classic sacrifice a
pawn to get the queen move.
❖
Choose one:
A) It’s a coincidence that we were bombarded by hysterical anti-Russia narratives for five years before this started.
B)
Bogus Russia scandals were cooked up by US intelligence to start
manufacturing consent for a confrontation with Russia to preserve US
unipolar hegemony.
❖
It
would bring a lot of clarity for a lot of people if we replaced the
term “no-fly zone” with “Directly Attack the Russian Military Zone”.
❖
“Whataboutism” is a common misspelling of “Damning evidence that western powers are lying about their motives and values.”
❖
Yes,
Smart Internet Person, I love Vladimir Putin. Can’t possibly be that
I’m criticizing the known wrongdoings of the mightiest power structure
in the world, it’s that I fell in love with some random government
official on the other side of the planet and want to suck his cock.
It’s
not like the US or its allies have ever done anything wrong, so they
couldn’t possibly have done anything to give rise to our current
situation, therefore it must be that I’m just kookoo for Putin Puffs.
We’re very good thinkers, you and I. Let’s go watch cartoons.
❖
Of course
I am aware that Vladimir Putin is no girl scout. That’s why I’ve been
warning for years that the west’s refusal to pursue detente could lead
us to nuclear war. There’d be nothing to worry about if the guy was a
cuddly wuddly snugglepoo.
❖
Having
a shit fit about someone criticizing the most powerful empire of all
time for actions which led to a fucking war is a great way to let
everyone know you have an infantile worldview and a piss weak
argument. If you say you hate this war but get upset when people talk
about the known ways the US-centralized empire helped cause it, then
your interest is not in peace, nor in freedom, nor in truth, but in
loyalty to that empire.
Learn more and think harder about the role NATO powers have played in starting this war.
Learn more and think harder about what sanctions are and what they do to people.
Learn more and think harder about what nuclear war is and what might cause it.
❖
Whenever
I talk about the frightening escalation in censorship and propaganda
we’re seeing in the west I get people telling me that Russia is
censoring and propagandizing even worse. Like “We’re a bit better than
Russia!” is a sane response to this assault on truth and freedom.
If
you feel the need to restrict and manipulate people’s speech, even if
what they’re saying is true, then your actions aren’t based on truth.
They’re based on something else, like geostrategic conquest.
Everything
the empire says it opposes Russia for is a lie. Everything the empire
criticizes Russia for are things the empire itself does. Everything
we’re told is on the line in this showdown — freedom, democracy, truth,
justice — are things the empire has been actively stomping out.
______________________________
My work is entirely reader-supported, so if you enjoyed this piece please consider sharing it around, following me on Facebook, Twitter, Soundcloud or YouTube, or throwing some money into my tip jar on Ko-fi, Patreon or Paypal. If you want to read more you can buy my books. The best way to make sure you see the stuff I publish is to subscribe to the mailing list for at my website or on Substack, which will get you an email notification for everything I publish. Everyone, racist platforms excluded, has my permission to
republish, use or translate any part of this work (or anything else
I’ve written) in any way they like free of charge. For more info on who I
am, where I stand, and what I’m trying to do with this platform, click here.
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar berichten over de oneindige VS terreur:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!!