Augusto Zimmermann en Gabriël Moens, twee Australische professoren, hebben een analyse gemaakt van de situatie in Oekraïne en komen, als is te verwachten van echte deskundigen, tot een heel andere conclusie dan die ons dag in dag uit met een enorme berg propaganda door de strot wordt geduwd, propaganda waarin Rusland als de grote agressor wordt voorgesteld, zonder ook maar met één van de redenen rekening te houden die Rusland heeft aangezet tot militair ingrijpen in Oekraïne. Militair ingrijpen dat in het westen door de reguliere (afhankelijke) media en politici wordt voorgesteld als de oorlog van Putin…… Men gaat in het westen zelfs zover dat men de bevolking voorhoudt dat Putin erop uit is om de oude Sovjet-Unie nieuw leven in te blazen en daarbij zelfs andere Europese landen zou willen aanvallen….. (totaal belachelijk!!)
Putin wordt door die media en politici zelfs neergezet als een moorddadige dictator die het opneemt tegen een democratisch land* (Oekraïne), waarbij men durft te stellen dat het ingrijpen van Rusland niet werd veroorzaakt door acties van derden…… Alsof men niet weet dat Rusland al sinds ongeveer 2004 keer op keer heeft geprotesteerd tegen de uitbreiding van de NAVO richting Moskou en daarbij in elk toegevoegd land aan dit uiterst agressieve bondgenootschap (altijd onder militair opperbevel van de VS) NAVO troepen stationeert en daarbij militaire oefeningen houdt, oefeningen gericht tegen Rusland en sinds jaren al aan de westgrens van Rusland, waarbij men o.a. oefent op het binnenvallen van Russisch grondgebied…..
Deze militaire oefeningen van de NAVO zijn zelfs meermaals uitgevoerd op Oekraïens grondgebied en in haar territoriale wateren en ook daar een paar keer gericht op het binnenvallen van Russisch grondgebied, terwijl Oekraïne nog steeds geen lid is van de NAVO…..
Waar het westen ook al geen belangstelling voor had en heeft is de al sinds 2014 bestaande oorlogsvoering van het Oekraïense leger (met neonazi-bataljons als Azov) tegen de burgers van de zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk, waarbij al minstens 13.000 van die burgers om het leven zijn gekomen (inclusief kinderen…..)…..
Zimmerman en Moens halen John J. Mearsheimer aan, professor aan de universiteit van Chicago, die al jaren stelt dat de benadering door Rusland van Oekraïne volkomen is te danken aan westerse interventie. Ook stelt hij dat de wil van de VS de NAVO uit te breiden richting de grens van Rusland een conflict tussen nucleair bewapende staten mogelijk heeft gemaakt en de fundering heeft gelegd voor Ruslands ‘agressieve houding’ tegen Oekraïne……
Maersheimer stelt dat het westen uiteraard nooit zichzelf de schuld zal geven voor het gebeuren in Oekraïne, maar de schuld alleen bij Rusland legt, waarbij ook hij zegt dat men zover gaat om te stellen dat Rusland (Putin) streeft naar een groot-Rusland of zelfs het herintroduceren van de Sovjet Unie…… (nogmaals: te belachelijk voor woorden!!)
Het voorgaande terwijl een ieder die het interesseert kan weten dat de coup in 2014 tegen Viktor Janoekovytsj, de democratisch gekozen president van Oekraïne, werd georganiseerd, geregisseerd en betaald door de VS, te weten door de destijds zittende Obama administratie……
Zimmermann en Moens gaan verder in op de coup tegen Janoekovytsj en dat deze inderdaad onconstitutioneel was, ook volgens de grondwet van Oekraïne….. Janoekovytsj tekende in feite voor deze VS coup daar hij na zijn verkiezing tot president in 2010 stelde dat Oekraïne niet verder het lidmaatschap van de NAVO nastreefde……
Jonh McCain, een oorlogshitser van formaat hield Oekraïne al in 2013 voor dat het land zich moest richten op de EU en niet op Rusland, terwijl een bondgenootschap met Rusland alleen maar voordeel op zou leveren en een bondgenootschap met de EU het land aanvankelijk een fikse som geld zou kosten…..
Na de installatie van een pro-VS/westerse neonazi-regering in Oekraïne, probeerde het land de opstand in het oosten van het land neer te slaan, echter dat lukte niet, en dat niet in de laatste plaats daar een deel van het Oekraïense leger deserteerde en zich met meegenomen wapens als enkele tanks de verdediging van het oosten ging bezighouden. De VS stelde toen dat Rusland Oekraïne destabiliseerde en maakte zo (met succes) van Rusland een pariastaat…… Ook destijds met grote hulp van de reguliere afhankelijke westerse media en politiek…..
Het neerhalen van MH17 werd volledig in de schoenen van Rusland geschoven, terwijl er zoveel zaken onbeantwoord zijn gebleven, om er een paar te noemen: hoe was het mogelijk dat Oekraïne op de dag dat de ramp met MH17 plaatsvond alle radarposten had uitgeschakeld?? (geen land zet voor onderhoud alle radarposten uit, dat is totaal onverantwoord en is vragen om ongelukken!!) Waarom week vlucht MH17 af van de normale koers en belandde zo boven oorlogsgebied?? Of hoe kan het dat men het rampgebied met een flink aantal mensen volledig had uitgekamd en een jaar later zet een journalist voet op datzelfde gebied en vindt vrijwel onmiddellijk een stuk van een Buk-raket??** Nogmaals dit zijn nog maar een paar van de zaken waarop nooit een antwoord is gegeven……. Eén ding is zeker: met het rapport over MH17 was de demonisering van Rusland compleet, een rapport waarin Bellingcat een belangrijke rol speelde, terwijl dat zogenaamde alternatieve journalisten collectief wordt betaald door de overheid van de VS, dezelfde overheid die vanaf het moment dat bekend werd dat MH17 was neergehaald, de schuld bij Rusland heeft gelegd…….
Ook in het hieronder opgenomen artikel volgt de conclusie dat men Rusland jarenlang heeft getart met de steeds verdergaande uitbreiding van de NAVO richting haar westgrens en dat Rusland eindelijk heeft gereageerd met een te verwachten actie (die uiteindelijk volledig is te danken aan de VS en haar agressieve militaire bondgenootschap t.w. de NAVO en wie nog steeds durft te zeggen dat de NAVO een verdedigingsorganisatie is, moet eindelijk eens tijd maken voor een afspraak met een goede psychiater)
Let wel: ik ben bepaald geen voorstander van oorlog, maar met de manier waarop het westen reageert op de door haarzelf veroorzaakte ellende, stevenen we af op een Derde Wereldoorlog en die is door niemand te winnen!! Het is de hoogste tijd voor het gezonde verstand en we ons niet langer laten leiden door een terreurentiteit als de VS, die waar het maar uitkomt oorlog voert en die landen kapotmaakt als ze niet braaf doen wat de deze terreurstaat voorschrijft……. (zo zijn door de illegale, niet met een VN-sanctie ondersteunde VS sancties sinds eind 90er jaren al bijna een miljoen mensen om het leven gekomen, waaronder een groot aantal kinderen, zo hebben de sancties van de regering Clinton tegen Irak de dood veroorzaakt van 500.000 kinderen…….) Vergeet voorts niet dat de VS alleen deze eeuw met haar illegale oorlogen al meer dan 5 miljoen mensen heeft vermoord en dan durven generaals van dat land zelfs openlijk te zeggen dat de VS een oorlog tegen Rusland en China kan winnen……. Verder heeft de VS al onder Obama laten weten het kernwapen niet langer als afschrikkingswapen te zien, maar als eerste aanvalswapen, zelfs in te zetten als het land met een grote cyberaanval te maken zou krijgen…….
Lees het artikel van Zimmermann en Moens en geeft het door >> nogmaals het is de hoogste tijd dat het gezonde verstand het overneemt van oorlogshitsers en voor overleg met Rusland en dat dit land eindelijk garanties krijgt dat men geen verdere uitbreiding van de NAVO zal nastreven of zelfs zal toestaan en dat men stopt met de burgers van de afgescheiden staatjes te bombarderen…… Van De Krim kan Rusland al helemaal geen afstand doen, immers daar liggen haar enige jaarrond ijsvrije marinehavens, alsof de VS dat niet wist toen het de opstand en coup in Oekraïne organiseerde en betaalde….. Voorts zou het westen eindelijk de wens van de bewoners van De Krim moeten accepteren: zij hebben zich massaal middels een door internationale waarnemers als eerlijk en goed beoordeeld referendum aangesloten bij Rusland.
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
(als
je het Engels niet machtig bent, kopieer dan de Engelse tekst en plak
die in deze
vertaalapp,
de app werkt snel en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt kan je kiezen voor Nederlands)
Ukrainian
Military Forces servicemen attend a military drill with Next generation
Light Anti-tank Weapon (NLAW) Swedish-British anti-aircraft missile
launchers at the firing ground of the International Center for
Peacekeeping and Security, near the western Ukrainian city of Lviv on
Jan. 28, 2022. (AFP via Getty Images)
According to the prevailing narrative, the Russian invasion of Ukraine must be entirely blamed on President Vladimir Putin.
The narrative discloses that the Russian invasion of Ukraine was an
“unprovoked Russian aggression” against a democratic country, and Putin
is a “murderous dictator” who desires to resuscitate the defunct Soviet
empire and may even seek to subjugate other European countries to
achieve this objective.
To give an example, the British tabloid, The Sun, even compares Putin to Hitler. According to its editorial, “it is paramount, as in 1939, that the free peoples of the West defeat this hideous new evil, this Hitler for our times.”
However, careful consideration of the Ukrainian crisis reveals that
there are more sides to this story, only one of which is being told.
John J. Mearsheimer is the R. Wendell Harrison Professor of Political
Science at the University of Chicago. For years, he has claimed that
the Russian approach towards Ukraine was primarily caused by “Western
intervention.”
Mearsheimer argues
that the United States, in pushing to expand NATO eastward, “has
increased the likelihood of war between nuclear-armed powers and laid
the groundwork” for Russia’s aggressive position toward Ukraine.
With regards to Ukraine, he comments that up until 2014, no one
envisioned the NATO and EU expansion as policies aimed at containing
Russia and nobody seriously thought Russia was a threat before Feb. 22,
2014.
Mearsheimer continues, stating “What happened is that this major
crisis broke out, and we had to assign blame, and of course we were
never going to blame ourselves. We were going to blame the Russians. So
we invented this story that Russia was bent on aggression in Eastern
Europe. Putin is interested in creating a greater Russia, or maybe even
re-creating the Soviet Union.”
It is therefore instructive to ascertain what happened to Ukraine in
2014—a coup supported by the American government, more specifically, by
the then Obama administration.
U.S.
President Barack Obama (R) shakes hands with Ukraine President Petro
Poroshenko in the Oval Office at the White House in Washington, on Sept.
18, 2014. (Mark Wilson/Getty Images)
With the victory of the pro-Russian candidate, Victor Yanukovych, in
the Ukrainian presidential elections of 2010, its parliament voted in
that same year to abandon NATO membership aspirations (pdf).
However, President Yanukovych, a democratically elected leader, was
arbitrarily and unconstitutionally removed from office in February 2014.
Prior to that coup, in December 2013, the late Senator John McCain, then a leading Republican voice on U.S. foreign policy, told leaders
of the Ukrainian opposition camped on Kyiv’s main square that “Ukraine
will make Europe better and Europe will make Ukraine better …. And the
destiny you seek lies in Europe.”
To understand why the removal of President Yanukovych was
unconstitutional, some facts about the Ukrainian Constitution must be
considered.
The Ukrainian Constitution lists four circumstances in which an
elected president may cease to exercise power before the end of their
term: retirement; inability to exercise their powers for reasons of
health; removal from office by the procedure of impeachment; and death.
The process of impeachment is laid down in Article 111, which
requires the Ukrainian Parliament to create a special temporary
investigation committee to formulate charges against the president, seek
evidence to justify the charges, and come to conclusions about the
president’s guilt.
Prior to a final vote of impeachment, this process also requires the
nation’s Constitutional Court to review the case and certify that the
procedure has been properly followed, and the Ukrainian Supreme Court to
certify that the acts of which the president is accused are worthy of
impeachment.
Finally, the removal of an elected president from power must be
approved by at least three-quarters of the members of Parliament.
On Feb. 22, 2014, this process of impeachment was not followed at
all. No investigation committee was formed, and no courts were involved
in the removal of the president. Instead, a bill was rushed through
Parliament to remove President Yanukovych from his office, although this
was not even supported by three-quarters of members of Parliament.
Russia’s
President Vladimir Putin (R) talks with Ukrainian President Viktor
Yanukovych during a signing ceremony at the Kremlin in Moscow, Russia,
on Dec. 17, 2013. (Alexander Nemenov/AFP via Getty Images)
“[Impeachment] has to involve the Constitutional Court, the Supreme
Court, and the Rada (the unicameral parliament of Ukraine). This is a
complicated and lengthy procedure. It was not carried out. Therefore,
from a legal perspective this is an undisputed fact,” Putin said.
When that “coup” of the Ukrainian Parliament succeeded in expelling
the country’s elected president, then American President, Barrack Obama,
misled the international community by hiding the imposition of a pro-Western government on “Russia’s most neuralgic and politically divided neighbour.”
Soon after a new government was established, it declared itself
unable to control the popular reaction to that coup in the country’s
east. The American government then conveniently accused Russia of
destabilising Ukraine, thus aiming to turn Russia into a “pariah state.”
Ukraine has never been able to have a functional government since.
Russia almost immediately retaliated by annexing the region of Crimea, in March 2014, but only after a popular referendum that was not recognized by the United States and its Western allies.
Crimeans, who mostly speak Russian, voted overwhelmingly to join the Russian Federation.
Writing for the American Conservative, foreign policy expert Dominick Sansone explains:
“The move into Crimea came as a response, to secure Russia’s key
naval interests in the warm-water port at Sevastopol. The coinciding
uprisings in the Donbas were additionally a response to the situation in
Kyiv … The official position of the Kremlin has subsequently been that
these ethnically Russian citizens should not be forced to live under the
rule of an illegitimate rebel group that illegally came to power by
overthrowing the duly elected government.”
The reality is that the eastward expansion of NATO has triggered the
current Ukrainian crisis, primarily because of Washington’s attempt to
pull Ukraine decisively into its orbit and defence structure by building
an explicitly anti-Moscow association and supporting a notoriously
corrupt government.
The Russian authorities believe that this constitutes a “direct
threat” to their national security and have they have bitterly opposed
NATO engagement since the mid-1990s. Further, it is the Russians, not
the Americans and their allies, “who ultimately get to decide what
counts as a threat to them” (pdf).
Russian
troops in uniforms without insignia are seen atop of a tank with the
letter “Z” painted on its sides, in the Donetsk region, Ukraine, on
March 1, 2022. (Alexander Ermochenko/Reuters)
Despite this important context, speaking to reporters
in Adelaide, on Feb. 24 the Australian Prime Minister, Scott Morrison,
stated: “We should be taking every step we can to ensure Russia pays a
price in the international community for the violent and aggressive acts
of invasion against Ukraine.”
Asked what he thought of the Russian president, Morrison replied: “I call him a thug.”
This sort of language is unwise and belligerent with 46 million
people and a vast territory that is rich in natural resources, Ukraine
is by far the largest and most impressive of the states that had split
away from the Russian Federation, in 1991.
Above all, the Australian prime minister has denied that Putin’s actions might be “motivated by legitimate security concerns.”
According to Seumas Milne, a British journalist and former Labour Party’s Executive Director of Strategy and Communications:
“No Russian government could have acquiesced in such a threat from
territory that was at the heart of both Russia and the Soviet Union.
Putin’s absorption of Crimea and support for the rebellion in eastern
Ukraine is clearly defensive, and the red line is now drawn: the east of
Ukraine, at least, is not going to be swallowed up by NATO or the EU.”
Commenting on the present situation in Ukraine, Bill Roggio, a senior
colleague at the Foundation for Defense of Democracy and editor of its
Long War Journal, states that:
“Putin appears to want to take Ukraine intact …. The systematic
nature of the Russian assault is at odds with the speculation that Putin
has lost control of his senses. Nobody knows for sure, but Putin’s
actions appear to be that of a cold and calculating adversary.
Dismissing his decision to invade Ukraine as a form of madness is
effectively an excuse to ignore Putin’s likely motivations and future
actions.”
The Russians had already been seriously humiliated by NATO’s decision
to expand the Alliance to include former Warsaw Pact countries. And now
they sense that NATO is dangerously moving right up to their border by
turning one of their most formidable former states into a de facto
member of the American military alliance.
Clearly, the Russians have reached the limits of their willingness to tolerate NATO’s expansionist policies.
The consequences of the unconstitutional coup of 2014 should be
blamed, at least in part, for Russia’s disastrous military invasion of
Ukraine.
Views expressed in this article are the opinions of the author and do not necessarily reflect the views of The Epoch Times.
Augusto Zimmermann is professor and head of law at
Sheridan Institute of Higher Education in Perth. He is also president of
the Western Australian (WA) Legal Theory Association and served as a
member of WA’s law reform commission from 2012 to 2017. Zimmermann is an
adjunct professor of the University of Notre Dame Australia, and has
co-authored several books including COVID-19 Restrictions &
Mandatory Vaccination—A Rule-of-Law Perspective (Connor Court)
Gabriël A. Moens AM is an emeritus professor of law
at the University of Queensland, and served as pro vice-chancellor and
dean at Murdoch University. In 2003, Moens was awarded the Australian
Centenary Medal by the prime minister for services to education. He has
taught extensively across Australia, Asia, Europe, and the United
States. Moens has recently published two novels “A Twisted Choice”
(Boolarong Press, 2020) and “The Coincidence” (Connor Court Publishing,
2021).
* Oekraïne is in feite geen democratisch land, zeker als je bedenkt dat al onder Porosjenko bepaalde politieke partijen verboden waren, waar Janoekovytj er nog vier aan heeft toegevoegd….. Voorts zijn er sinds de coup van 2014 al een flink aantal journalisten vermoord in Oekraine….. Daarnaast oefenen neonazi-groeperingen controle uit op de ‘regering’ en media van Oekraïne….. Ook is het overduidelijk dat de VS in feite aan de touwen trekt in dat land.
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar berichten over de oneindige VS terreur:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!! Gisternacht
(15 maart 2022/////) maakte CBC Radio1 bekend dat de uitlevering van
Assange weer een stap dichterbij is gekomen >> de rechter heeft
gesteld dat Julian Assange mensenlevens in gevaar heeft gebracht en dat
dit een reden zou kunnen zijn tot uitlevering van Julian aan de grootste
terreurentiteit ter wereld: de VS, terwijl deze leugen al lang en breed
is doorgeprikt…….. SCHANDE!!!!
Vanaf vandaag zijn verpleegkundigen en is verzorgend personeel in Duitsland verplicht zich te laten vaccineren tegen COVID-19 en wel met 3 vaccinaties…… Ondanks een fiks tekort aan verpleegkundigen en verzorgenden, plus het feit dat de omicron-variant van het virus is te vergelijken met een fikse griep, moeten deze mensen zich laten vaccineren, waar de eerste 2 vaccinaties in feite geen zin meer hebben……
In wat men eerder West-Duitsland noemde (BRD) zouden de meeste van de verpleegkundigen en verzorgenden al zijn gevaccineerd en dat voor meer dan 95% van deze groepen, waarbij men wel vergeet te vermelden dat veel verpleegkundigen en verzorgenden sinds de uitbraak van het virus hun beroep vaarwel hebben gezegd, vandaar ook dat zelfs als er maar een paar van deze mensen weigeren zich te laten vaccineren en deze ontslagen zouden moeten worden, dit grote problemen zal opleveren voor de instelling waar ze werken….
In het vroegere Oost-Duitsland is de situatie heel anders, daar zou zo’n 20% van de verpleegkundigen en verzorgenden zich weigeren te laten vaccineren…..
Gezien het voorgaande is het dan ook niet vreemd dat men voorlopig geen actie verwacht tegen degenen die zich weigeren te laten vaccineren…… Uiteraard zijn mensen die zich niet mogen laten vaccineren om de één of andere reden uitgesloten van de verplichting tot vaccinatie…. Hoewel ‘uiteraard?’ De Duitse overheid stelt dat verplichte vaccinatie nodig is daar verpleegkundigen en verzorgenden juist omgang hebben met oudere dan wel anderszins lichamelijk zwakkere mensen die makkelijk een besmettelijke ziekte oplopen, vreemd dan dat er toch uitzonderingen gemaakt worden (althans als je geloof hecht aan het nut van vaccinaties)……
Daarop doorgaand: het is al lang duidelijk dat gevaccineerden even besmettelijk kunnen zijn (en dat ook daadwerkelijk zijn) dan niet gevaccineerden, iets dat het Robert Koch Instituut* (RKI) en andere ‘deskundigen’ in Duitsland met oogkleppen op blijven ontkennen….. (het RKI is te vergelijken met ons RIVM)
Het verplichten op uiterst dubieuze gronden tot het zich verplicht laten injecteren en dat ook nog eens met een experimenteel vaccin gaat in tegen mensenrechten en grondrechten, ook in Duitsland…… Bourla, de CEO van Pfizer, heeft openlijk gezegd dat gevaccineerden de komende jaren in feite dienen als test personen** (proefdieren) en dat kan gezien de normale testperiode voor een vaccin tot 10 jaar duren…… Buiten dat hebben de grote farmaceuten die COVID-vaccins maken geëist van de landen waar hun vaccin wordt verspreid dat ze niet aansprakelijk mogen worden gesteld voor bijwerkingen op de korte, middellange en lange termijn >> dit gaat zover dat Pfizer heeft afgezien van een contract met India, daar de regering van dat land extra veiligheidsgaranties eiste….. Ga maar na hoeveel winst Pfizer had kunnen maken in een land met meer dan 1,3 miljard inwoners, maar toch is gestopt met de onderhandelingen……
Ondanks dat alles gaat Duitsland gewoon door met het verplicht stellen van vaccinatie voor verplegend personeel (en wellicht op termijn voor alle Duitsers…)…. Ook die Grünen zijn voor verplichting van vaccinatie voor verplegend personeel, terwijl het een partij is te vergelijken met ‘GroenLinks’ (GL) hier en al even fout als GL, de Duitse minister van BuZa, Baerbock van die Grünen, schreeuwde het een aantal maanden geleden uit dat ze achter een algemene vaccinatieplicht staat…… Dat durft men tegenwoordig progressief te noemen…….
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
* Robert Koch was een ‘medicus’ die vele duizenden mensen in destijds Duitse kolonie Namibië heeft vermoord met o.a. experimentele vaccins en injecties met gevaarlijke stoffen om te zien wat de reactie was….. In feite was deze Koch een voorloper van Mengele, de nazi-concentratiekamp arts die ontelbaar velen heeft vermoord, o.a. op dezelfde manier die Koch gebruikte…… Totaal ongelofelijk dan ook dat men in Duitsland het Robert Koch instituut niet allang heeft voorzien van een andere naam…… Schande!!! Zie wat dat betreft ook: ‘Parallellen tussen nazi en VS medicijnen‘
** Zie: ‘Pfizer CEO: Israëliërs zijn proefkonijn voor testen van vaccin‘ (!!!!) De brutaliteit…… De CEO van Pfizer die zonder blikken of blozen aangeeft waar het om gaat als men gevaccineerd is……. Israël
waar intussen velen al spijt hebben zich te hebben laten
vaccineren….. Onlangs (het is nu 16 maart 2022/////) heeft Pfizer afgezien van een contract met
India, daar het land extra garanties wilde over de veiligheid en daar
zag Pfizer geen brood in…… India een land met een bevolking van 1,3
miljard mensen, ofwel daar was genoeg winst te behalen voor Pfizer; moet
je nagaan….. Er is nog een groot land dat extra veiligheid eiste,
waarop Pfizer ook de stekker uit die onderhandelingen trok….. Als je
hier naar zoekt op het net, maakt niet uit op wat voor manier, vind je
hier niets over terug, tekenend……..
‘Pfizer Coronavirus vaccin: wat je niet wordt verteld over de vaccins tegen COVID-19‘
In augustus 2020 deed Pfizer CEO Bourla 62% van z’n aandelen Pfizer van
de hand, blijkbaar heeft hij er geen vertrouwen in dat de beloften van
overheden dat het bedrijf niet vervolgd zal worden voor ernstige
bijwerkingen ook zullen worden geëerbiedigd door rechters mocht men het
bedrijf aanklagen voor doden als gevolg van vaccinatie dan wel voor ernstige (chronische)
bijwerkingen……
‘Intrekken uitzendlicentie door Rusland voor Deutsche Welle ‘is een klap in het gezicht van het Duitse volk’‘
RT Deutsch dat werd platgelegd in Duitsland wordt o.a. verweten
complottheorieën over COVID te brengen, dit door het uitzenden van een
gesprek met een paar COVID-vaccinatieweigeraars……. (te zot voor
woorden!!) Oh, en Deutsche Welle is een Duitse staatsomroep die westerse
propaganda uitzond in Rusland, iets
waarover men niet lult in het westen en als men er al over spreeekt
wordt er onomwonden gezegd dat dit soort westerse platforms
onafhankelijk zijn….. ha! ha! ha! ha! ha! ha! ha!
‘COVID-19 vaccin zou het immuunsysteem aantasten…….‘ (!!!!)
Benieuwd ook of de vandaag (het is terwijl ik dit schrijf 11 januari 2022 /////) overleden
David Sassoli, voorzitter van het EU parlement, 3 dubbel gevaccineerd
was, daar ook hij een afwijking had aan het immuunsysteem……
‘Coronavirus: paniek over de Deltavariant is onterecht en zwaar overdreven‘ (!!!!)
En zie de links in dat bericht naar artikelen over de PCR test en de
bezuinigingen op de gezondheidszorg >> die bezuinigingen zijn de
reden voor de
Coronamaatregelen, die werden immers genomen daar er te weinig
ziekenhuisbedden, IC bedden en verpleegkundigen waren. Zoals ook in het bericht hierboven al gemeld: het aantal
verpleegkundigen is als de bedden sterk teruggelopen door wanbeleid van
de afbraakkabinetten Rutte 1, 2 en 3….. Zo waren er bij aantreden van
Rutte 1 nog 2.200 IC bedden, dat was bij aanvang van de Coronacrisis
teruggebracht naar 1.100 bedden….. Dus als je sterk bent
benadeeld door de Coronamaatregelen, weet je wie hiervoor
verantwoordelijk zijn!! Zie wat betreft dat bericht ook: ‘Coronavirus: artsen willen via rechtszaak tegen de staat COVID-19 van A-lijst krijgen, daar het een griepvirus zou zijn‘De video die oorspronkelijk in het artikel was te zien is
gecensureerd, tja je wilt natuurlijk niet dat de bevolking begrijpt
hoezeer men werd en wordt belazerd……
‘Coronabeslommeringen: ook na vaccinatie kan je het virus doorgeven, plus de zoveelste blunder van CDA minister de Jonge‘
Het na dit bericht gebrachte nieuws dat je niet besmettelijk bent na
vaccinatie, is achteraf gebeleken grote onzin te zijn en zou gebaseerd
zijn op een
foute interpretatie van een bericht uit de VS, lijkt me ook logisch daar
dr Fauci eerder al meldde dat gevaccineerden nog lang besmettelijk
blijven en zich aan de Coronamaatregelen dienen te houden, terwijl de
voormaligfe minister van Volksgezodnheid, CDA plork fde Jonge vorig jaar
zelf toegaf dat gevaccineerden niet veilig zijn…… (zie de
afbeelding met deze zwaar disfunctionerende kwezel in het eerste blok met links naar artikelen over Pfizer)
De westerse anti-Russische propaganda wordt op een dermate manier gebracht dat men nog amper kan geloven dat het Oekraïense leger ook maar iets verkeerd zou kunnen doen……. Uiteraard heeft dit ook te maken met het feit dat de reguliere westerse media er jarenlang het zwijgen toe hebben gedaan als het gaat om het bombarderen van burgers door het Oekraïense leger, dan wel de burgers van de afgescheiden staatjes Luhansk en Donetsk af te schilderen als ‘Russian backed rebels’, zonder ook maar met een letter aan te geven waarom deze mensen besloten niet langer onderdeel te willen zijn van Oekraïne……
De burgers hadden alle reden om zich af te scheiden van Oekraïne, nadat de ook door hen democratisch gekozen president Janoekovytsj werd afgezet middels een door de VS betaalde, georganiseerde en geregisseerde opstand….. Daarbij kregen neonazi-groepen de controle over de door de VS geïnstalleerde junta, die werd geleid door de zwaar corrupte neonazi Porosjenko (met bankrekeningen in het buitenland, o.a. meerdere in Nederland….)…… Het is zelfs de taak van een volk om in verzet te komen als een door hen democratisch gekozen president wordt afgezet en wordt vervangen door een figuur als Porosjenko, een door de VS aangewezen dictator……
De media hebben willens en wetens gekozen voor de door de VS aangewezen corrupte hufter Porosjenko en herhaalden daarnaast keihard de leugen van de VS dat Rusland De Krim zou hebben geannexeerd, terwijl de bevolking van De Krim, inclusief de oorspronkelijke bevolking en de Oekraïners, na de coup tegen de ook door hen democratisch gekozen president Janoekovytsj in een door internationale waarnemers als eerlijk en goed verlopen referendum massaal kozen voor aansluiting bij Rusland….. De westerse media hadden en hebben zelfs het gore lef te stellen dat het referendum niet eerlijk is verlopen en dat op basis van het niet erkennen van dit referendum door de VS en andere westerse landen….. (nogmaals: terwijl internationale waarnemers dit referendum als eerlijk en goed verlopen beoordeelden!!)
Niet vreemd dan ook dat het publiek opschrikt uit een comateuze slaap als iemand op tv een ander verhaal vertelt dan wat hen continu wordt voorgehouden. Dit gebeurde in Frankrijk waar oorlogsjournalist Anne-Laure Bonnel het publiek vertelde wat de bewoners van de afgescheiden staatjes Luhansk en Donetsk al 8 jaar voor hun kiezen krijgen >> bombardementen door neonazi-bataljons van het Oekraïense leger, waarbij meer dan 13.000 mensen (inclusief kinderen) om het leven zijn gekomen, ofwel die werden vermoord door het Oekraïense leger…… Tja wat moet je dan als je er tot dan toe van overtuigd was dat het Oekraïense leger goed en het Russische leger slecht is?? De wapenstilstanden van Minsk, inclusief akkoorden over terugtrekking van zware wapens uit het gebied, werden keer op keer geschonden door de Oekraïense neonazi-bataljons, echter in het westen stellen de media doodleuk dat beide partijen deze verdragen hebben geschonden….. Welk belang zouden de burgers van de afgescheiden staatjes Luhansk en Donetsk hebben bij het schenden van de verdragen, anders dan terugslaan wanneer ze weer worden aangevallen….. Gisteren kwamen in Donetsk 20 burgers om het leven bij een bombardement van de neonazi-bataljons van het Oekraïense leger, iets waar noch de westerse media noch politici aandacht voor hebben…….
Gisteren heeft Zelensky het Canadese parlement toegesproken, daarbij stelde deze bedrieger dat men zich moet voorstellen dat een buitenlandse dictator burgers, inclusief kinderen vermoordt en dat men in het westen weigert een ‘no fly zone’ in te stellen…. (uiteraard bracht hij e.e.a. met veel meer [valse] emoties en ‘tranentrekkende verhalen’) Zelensky is bijna 3 jaar president en in die 3 jaar hebben zijn troepen de burgers van de afgescheiden staatjes Luhansk en Donetsk op dezelfde manier gebombardeerd en doen dat nog steeds zoals je zojuist kon lezen, maar dat kon en kan hem blijkbaar niet deren, terwijl hij minstens 1 maal dat front heeft bezocht en al van voor zijn aantreden als president moet hebben geweten wat er in Oost-Oekraïne gebeurde……..
Onder het volgende artikel van 9 for news, nog een dergelijk verhaal, maar dan over een vrouw die 25 jaar in Frankrijk woont en die over de situatie in Oekraïne stelde dat daar 2 miljoen mensen in erbarmelijke omstandigheden leven en de energierekening niet meer kunnen betalen (terwijl de westerse media hoog van de toren blazen dat velen in Oekraïne geen verwarming of elektriciteit hebben door de acties van het Russische leger…..)
Eén van de presentatoren vroeg de vrouw op een gegeven moment verbaasd of ze sprak over de Oekraïense president Zelensky toen ze sprak over een president en zijn marionettenregering, wat werd bevestigd door de vrouw….. ha! ha! ha! ha! ha! De reden voor de vraag was dat de vrouw, ene Victoria, vroeg waarom de president en zijn marionettenregering zo moet worden verdedigd in de media, terwijl de economie in elkaar is gezakt en de corruptie nog steeds wijdverspreid is…… Verder stelde ze dat Zelensky 4 tv-stations heeft gesloten en dat er (ook) onder zijn bewind Oekraïense en Russische journalisten zijn vermoord…….. (waarover niet wordt bericht in de reguliere westerse media
Ik moet zeggen dat ik eigenlijk nooit meer naar dergelijke programma’s op tv kijk, maar vraag me wel af of dergelijke stemmen zoals hieronder beschreven wel op de Nederlandse tv te zien zullen zijn. Ik vrees dat de vraag stellen hetzelfde is als haar beantwoorden…..
(On the top right hand side of this page you can choose for a translation in the language of your choice: choose ‘Engels’ [english] so you can recognise your own language [the Google translation is first in dutch, a language most people don’t understand, while on the other hand most people recognise there language translated in english])
Franse oorlogsjournalist schokt kijkers: ‘Oekraïense leger bombardeert eigen burgers’
De Franse oorlogsjournalist Anne-Laure Bonnel doet vanuit Donbass verslag van de oorlog in Oekraïne. Dinsdag was ze te zien op de Franse nieuwszender CNews. Beelden van de uitzending werden massaal gedeeld op social media.
“We praten een week over dit conflict, maar het duurt al acht jaar,” sprak Bonnel. “Er zijn 13.000 doden gevallen, mensen zijn uitgeput.” Volgens de journalist wordt de burgerbevolking in Donbass gebombardeerd door het Oekraïense leger. “Ik heb het bewijs, het staat buiten kijf,” zei Bonnel.
Aantal aanvallen toegenomen
Dinsdag was ze in Donetsk waar rond 15.30 uur lokale tijd twee burgers waren omgekomen bij een bombardement door het Oekraïense leger. “Er woedt al acht jaar een burgeroorlog. 13.000 doden. De afgelopen drie dagen is het aantal aanvallen toegenomen,” schrijft ze op Facebook. Let op: de beelden kunnen als schokkend worden ervaren. In het filmpje is te zien dat het bombardement een flinke ravage heeft aangericht. “Het spijt me, maar dit is oorlog.”
De Franse journalist Bernard-Henri Lévy zei dat hij twijfelt aan de echtheid van de beelden. Bonnel zette vervolgens foto’s van de slachtoffers op social media om te laten zien dat ze authentiek zijn.
‘Terroristen’
Woensdag was de oorlogsjournalist in een voorstad van Donetsk, waar ze sprak met een oma van 83 jaar. Het huis van haar buurman is opgeblazen door een Oekraïense granaat.
Op Facebook schrijft Bonnel verder dat de regering in Kiev al jarenlang elke dag de bevolking in Oost-Oekraïne bombardeert. Ook worden pensioenen en salarissen van ambtenaren en artsen niet langer uitbetaald. Mensen worden uitgehongerd. De autoriteiten hebben bepaald dat de miljoenen Oekraïense burgers die in Loehansk en Donetsk wonen, ’terroristen’ zijn, zegt ze.
Afgelopen donderdag was ene Victoria, een Oekraïense vrouw die al 25 jaar in Frankrijk woont, te gast in het programma Brunet & Cie op de Franse nieuwszender LCI, om de kijker bij te praten over de situatie in Oekraïne. De presentatoren hadden waarschijnlijk verwacht dat de vrouw een tirade zou afsteken tegen Poetin, maar er gebeurde iets heel anders.
De vrouw zei dat twee miljoen mensen onder erbarmelijke omstandigheden leven in Oekraïne. Ze zei dat de energierekening flink is gestegen en dat veel mensen de helft van hun salaris kwijt zijn aan stookkosten.
“Waarom zouden we deze president en zijn marionettenregering moeten verdedigen?” vroeg Victoria. “De economie zakt in elkaar, corruptie is wijdverspreid.” Presentator Eric Brunet vroeg zich verbijsterd af: “Heeft u het over Zelensky?”
“Natuurlijk, wie anders?” zei ze. “Hij is absoluut geen democratisch leider. Hij heeft vier tv-stations gesloten. Er zijn journalisten verdwenen. Mensen zeggen dat Russische journalisten aan de lopende band worden vermoord. Er worden ook Oekraïense journalisten vermoord. De afgelopen jaren zijn er veel journalisten gedood.”
Staatsgreep
Brunet vroeg Victoria of het klopt dat sommige inwoners van Kiev blij zijn dat de Russen het land zijn binnengevallen. “Absoluut,” antwoordde ze, toevoegende dat veel Oekraïners betwijfelen of de verkiezingen eerlijk zijn verlopen.
Brunet zei vervolgens dat er democratische methoden zijn om de overheid te veranderen als je ontevreden bent over de gang van zaken. Daarop zei één van de gasten: “Vergeet niet dat er in februari 2014 een staatsgreep is gepleegd tegen de democratisch gekozen president.”
==========================================
Zie ook: ‘The Coup That Caused the Ukraine Conflict‘ (!!!!) Twee westerse professoren binden het westen en dan met name de VS de ‘oorlogsbel’ aan. (zal op een later moment dit bericht met een inleiding brengen)
Foto van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze hebben de laatste 8 jaar de steden en dorpen van de zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al hebben ze alsnog veel slachtoffers gemaakt onder burgers in die staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die hieronder is te vinden.
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘ (!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO trouwens de normaalste zaak van de wereld: dat steunen van fascisten…..) En dan te bedenken dat premier Rutte en minister van Buitenlandse Zaken Hoekstra onlangs een krans hebben gelegd bij een monument voor met name omgekomen neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En nogmaals: het is de allerhoogste tijd dat journalist Julian Assange wordt vrijgelaten uit de smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS (toegegeven in officiële gelekte documenten van de VS!!!)……. Het is zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze documenten plus beeldmateriaal zijn te vinden in WikiLeaks!! Gisternacht (15 maart 2022/////) maakte CBC Radio1 bekend dat de uitlevering van Assange weer een stap dichterbij is gekomen >> de rechter heeft gesteld dat Julian Assange mensenlevens in gevaar heeft gebracht en dat dit een reden zou kunnen zijn tot uitlevering van Julian aan de grootste terreurentiteit ter wereld: de VS, terwijl deze leugen al lang en breed is doorgeprikt…….. SCHANDE!!!!
De westerse anti-Russische propaganda wordt op een dermate manier gebracht dat men nog amper kan geloven dat het Oekraïense leger ook maar iets verkeerd zou kunnen doen……. Uiteraard heeft dit ook te maken met het feit dat de reguliere westerse media er jarenlang het zwijgen toe hebben gedaan als het gaat om het bombarderen van burgers door het Oekraïense leger, dan wel de burgers van de afgescheiden staatjes Luhansk en Donetsk af te schilderen als ‘Russian backed rebels’, zonder ook maar met een letter aan te geven waarom deze mensen besloten niet langer onderdeel te willen zijn van Oekraïne……
De burgers hadden alle reden om zich af te scheiden van Oekraïne, nadat de ook door hen democratisch gekozen president Janoekovytsj werd afgezet middels een door de VS betaalde, georganiseerde en geregisseerde opstand….. Daarbij kregen neonazi-groepen de controle over de door de VS geïnstalleerde junta, die werd geleid door de zwaar corrupte neonazi Porosjenko (met bankrekeningen in het buitenland, o.a. meerdere in Nederland….)…… Het is zelfs de taak van een volk om in verzet te komen als een door hen democratisch gekozen president wordt afgezet en wordt vervangen door een figuur als Porosjenko, een door de VS aangewezen dictator……
De media hebben willens en wetens gekozen voor de door de VS aangewezen corrupte hufter Porosjenko en herhaalden daarnaast keihard de leugen van de VS dat Rusland De Krim zou hebben geannexeerd, terwijl de bevolking van De Krim, inclusief de oorspronkelijke bevolking en de Oekraïners, na de coup tegen de ook door hen democratisch gekozen president Janoekovytsj in een door internationale waarnemers als eerlijk en goed verlopen referendum massaal kozen voor aansluiting bij Rusland….. De westerse media hadden en hebben zelfs het gore lef te stellen dat het referendum niet eerlijk is verlopen en dat op basis van het niet erkennen van dit referendum door de VS en andere westerse landen….. (nogmaals: terwijl internationale waarnemers dit referendum als eerlijk en goed verlopen beoordeelden!!)
Niet vreemd dan ook dat het publiek opschrikt uit een comateuze slaap als iemand op tv een ander verhaal vertelt dan wat hen continu wordt voorgehouden. Dit gebeurde in Frankrijk waar oorlogsjournalist Anne-Laure Bonnel het publiek vertelde wat de bewoners van de afgescheiden staatjes Luhansk en Donetsk al 8 jaar voor hun kiezen krijgen >> bombardementen door neonazi-bataljons van het Oekraïense leger, waarbij meer dan 13.000 mensen (inclusief kinderen) om het leven zijn gekomen, ofwel die werden vermoord door het Oekraïense leger…… Tja wat moet je dan als je er tot dan toe van overtuigd was dat het Oekraïense leger goed en het Russische leger slecht is?? De wapenstilstanden van Minsk, inclusief akkoorden over terugtrekking van zware wapens uit het gebied, werden keer op keer geschonden door de Oekraïense neonazi-bataljons, echter in het westen stellen de media doodleuk dat beide partijen deze verdragen hebben geschonden….. Welk belang zouden de burgers van de afgescheiden staatjes Luhansk en Donetsk hebben bij het schenden van de verdragen, anders dan terugslaan wanneer ze weer worden aangevallen….. Gisteren kwamen in Donetsk 20 burgers om het leven bij een bombardement van de neonazi-bataljons van het Oekraïense leger, iets waar noch de westerse media noch politici aandacht voor hebben…….
Gisteren heeft Zelensky het Canadese parlement toegesproken, daarbij stelde deze bedrieger dat men zich moet voorstellen dat een buitenlandse dictator burgers, inclusief kinderen vermoordt en dat men in het westen weigert een ‘no fly zone’ in te stellen…. (uiteraard bracht hij e.e.a. met veel meer [valse] emoties en ‘tranentrekkende verhalen’) Zelensky is bijna 3 jaar president en in die 3 jaar hebben zijn troepen de burgers van de afgescheiden staatjes Luhansk en Donetsk op dezelfde manier gebombardeerd en doen dat nog steeds zoals je zojuist kon lezen, maar dat kon en kan hem blijkbaar niet deren, terwijl hij minstens 1 maal dat front heeft bezocht en al van voor zijn aantreden als president moet hebben geweten wat er in Oost-Oekraïne gebeurde……..
Onder het volgende artikel van 9 for news, nog een dergelijk verhaal, maar dan over een vrouw die 25 jaar in Frankrijk woont en die over de situatie in Oekraïne stelde dat daar 2 miljoen mensen in erbarmelijke omstandigheden leven en de energierekening niet meer kunnen betalen (terwijl de westerse media hoog van de toren blazen dat velen in Oekraïne geen verwarming of elektriciteit hebben door de acties van het Russische leger…..)
Eén van de presentatoren vroeg de vrouw op een gegeven moment verbaasd of ze sprak over de Oekraïense president Zelensky toen ze sprak over een president en zijn marionettenregering, wat werd bevestigd door de vrouw….. ha! ha! ha! ha! ha! De reden voor de vraag was dat de vrouw, ene Victoria, vroeg waarom de president en zijn marionettenregering zo moet worden verdedigd in de media, terwijl de economie in elkaar is gezakt en de corruptie nog steeds wijdverspreid is…… Verder stelde ze dat Zelensky 4 tv-stations heeft gesloten en dat er (ook) onder zijn bewind Oekraïense en Russische journalisten zijn vermoord…….. (waarover niet wordt bericht in de reguliere westerse media
Ik moet zeggen dat ik eigenlijk nooit meer naar dergelijke programma’s op tv kijk, maar vraag me wel af of dergelijke stemmen zoals hieronder beschreven wel op de Nederlandse tv te zien zullen zijn. Ik vrees dat de vraag stellen hetzelfde is als haar beantwoorden…..
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
Franse oorlogsjournalist schokt kijkers: ‘Oekraïense leger bombardeert eigen burgers’
De Franse oorlogsjournalist Anne-Laure Bonnel doet vanuit Donbass verslag van de oorlog in Oekraïne. Dinsdag was ze te zien op de Franse nieuwszender CNews. Beelden van de uitzending werden massaal gedeeld op social media.
“We praten een week over dit conflict, maar het duurt al acht jaar,”
sprak Bonnel. “Er zijn 13.000 doden gevallen, mensen zijn uitgeput.”
Volgens de journalist wordt de burgerbevolking in Donbass gebombardeerd
door het Oekraïense leger. “Ik heb het bewijs, het staat buiten kijf,”
zei Bonnel.
Aantal aanvallen toegenomen
Dinsdag was ze in Donetsk waar rond 15.30 uur lokale tijd twee
burgers waren omgekomen bij een bombardement door het Oekraïense leger.
“Er woedt al acht jaar een burgeroorlog. 13.000 doden. De afgelopen drie
dagen is het aantal aanvallen toegenomen,” schrijft ze op Facebook.
Let op: de beelden kunnen als schokkend worden ervaren. In het filmpje
is te zien dat het bombardement een flinke ravage heeft aangericht. “Het
spijt me, maar dit is oorlog.”
De Franse journalist Bernard-Henri Lévy zei dat hij twijfelt aan de
echtheid van de beelden. Bonnel zette vervolgens foto’s van de
slachtoffers op social media om te laten zien dat ze authentiek zijn.
‘Terroristen’
Woensdag was de oorlogsjournalist in een voorstad van Donetsk, waar ze sprak met een oma van 83 jaar. Het huis van haar buurman is opgeblazen door een Oekraïense granaat.
Op Facebook schrijft Bonnel verder
dat de regering in Kiev al jarenlang elke dag de bevolking in
Oost-Oekraïne bombardeert. Ook worden pensioenen en salarissen van
ambtenaren en artsen niet langer uitbetaald. Mensen worden uitgehongerd.
De autoriteiten hebben bepaald dat de miljoenen Oekraïense burgers die
in Loehansk en Donetsk wonen, ’terroristen’ zijn, zegt ze.
Afgelopen
donderdag was ene Victoria, een Oekraïense vrouw die al 25 jaar in
Frankrijk woont, te
gast in het programma Brunet & Cie op de Franse nieuwszender
LCI, om de kijker bij te praten over de situatie in Oekraïne.
De presentatoren hadden waarschijnlijk verwacht dat de vrouw een
tirade zou afsteken tegen Poetin, maar er gebeurde iets heel anders.
De vrouw zei dat twee miljoen mensen onder erbarmelijke
omstandigheden leven in Oekraïne. Ze zei dat de energierekening flink is
gestegen en dat veel mensen de helft van hun salaris kwijt zijn aan
stookkosten.
futurebrain
@futurebrain1
Woman tells truth about Ukraine live on French media. Hosts are stunned. Part 1 video
“Waarom zouden we deze president en zijn marionettenregering moeten
verdedigen?” vroeg Victoria. “De economie zakt in elkaar, corruptie is
wijdverspreid.” Presentator Eric Brunet vroeg zich verbijsterd af:
“Heeft u het over Zelensky?”
“Natuurlijk, wie anders?” zei ze. “Hij is absoluut geen democratisch
leider. Hij heeft vier tv-stations gesloten. Er zijn journalisten
verdwenen. Mensen zeggen dat Russische journalisten aan de lopende band
worden vermoord. Er worden ook Oekraïense journalisten vermoord. De
afgelopen jaren zijn er veel journalisten gedood.”
Staatsgreep
Brunet vroeg Victoria of het klopt dat sommige inwoners van Kiev blij
zijn dat de Russen het land zijn binnengevallen. “Absoluut,” antwoordde
ze, toevoegende dat veel Oekraïners betwijfelen of de verkiezingen
eerlijk zijn verlopen.
Brunet zei vervolgens dat er democratische methoden zijn om de
overheid te veranderen als je ontevreden bent over de gang van zaken.
Daarop zei één van de gasten: “Vergeet niet dat er in februari 2014 een
staatsgreep is gepleegd tegen de democratisch gekozen president.”
==========================================
Zie ook: ‘The Coup That Caused the Ukraine Conflict‘ (!!!!) Twee westerse professoren binden het westen en dan met name de VS de ‘oorlogsbel’ aan. (zal op een later moment dit bericht met een inleiding brengen)
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar berichten over de oneindige VS terreur:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!! Gisternacht
(15 maart 2022/////) maakte CBC Radio1 bekend dat de uitlevering van
Assange weer een stap dichterbij is gekomen >> de rechter heeft
gesteld dat Julian Assange mensenlevens in gevaar heeft gebracht en dat
dit een reden zou kunnen zijn tot uitlevering van Julian aan de grootste
terreurentiteit ter wereld: de VS, terwijl deze leugen al lang en breed
is doorgeprikt…….. SCHANDE!!!!
De hysterie was compleet toen Oekraïne vorige week woensdag bekend maakte dat Rusland een kinderziekenhuis annex kraamkliniek in het Oekraïense Marioepol had gebombardeerd. Het deed mij sterk denken aan de leugens voorafgaand aan de oorlog van de VS tegen Irak, die begon op 2 augustus 1990, toen de VS met grote zekerheid loog dat Iraakse militairen in Koeweit couveuses zouden hebben gestolen en de baby’s op de grond zouden hebben gegooid…… Een enorme leugen die de VS misbruikte om de eerste oorlog tegen Irak te starten en te legitimeren…….
Achteraf blijkt dat het Oekraïense leger eind februari het kinderziekenhuis al had gevorderd…. Hetzelfde geldt voor een kleuterschool in Marioepol die de Russen zouden hebben gebombardeerd, ook dat gebouw was door het leger gevorderd en in dit geval door het neonazi-bataljon Azov…… Wat betreft de kleuterschool: deze zou zelfs zijn vernield door de neonazi’s, om zo de schuld in de schoenen van het Russische leger te kunnen schuiven…..
Deze zaak toont ten overvloede nog eens aan dat de Oekraïense overheid net zo makkelijk liegt als die van de VS* en daarmee hoopt deze overheid zaken voor elkaar te krijgen als een ‘no fly zone’, nog meer wapens en het liefst ingrijpen van de NAVO…….. Verder durft de Oekraïense president Zelensky te zeggen dat Rusland elke Oekraïner wil vermoorden, totaal belachelijk, ‘maar goed….’ Niet vreemd ook dat dezelfde Zelensky stelt dat Rusland niet op zal houden als het Oekraïne heeft ingenomen, maar door zal gaan, alsof Putin en de rest van de Russische regering gek zijn geworden….. (immers elke aanval tegen een NAVO-lidstaat zou onmiddellijk tot de niet te winnen Derde Wereldoorlog [WOIII] leiden…..)
Meer dan belachelijk dat men ook in het westen met grote graagte meewerkt aan dergelijke desinformatie en ronduit anti-Russische propaganda. Afgelopen zondagmorgen op Radio 1 rond 8.15 u. NOS verslaggever Jeroen de Jager die berichtte vanuit Lviv. Hem werd gevraagd wat hij had gemerkt van de raketten die Rusland zou hebben afgevuurd op een militaire basis, 30 kilometer van de Russische grens. Wel daar had hij getuigen naar gevraagd en die spraken over harde knallen, maar verder hadden deze ‘getuigen’ niets gezien….. Als ik me niet vergis sprak de Jager over 30 raketten, terwijl het om 8 raketten ging….. Heb gistermorgen geprobeerd dit onderdeel van de NOS uitzending terug te luisteren, echter het is niet meer terug te vinden, dus verwijderd….. Blijkbaar ging deze ‘blindganger’ van de Jager zelfs de afhankelijke NOS redactie te ver……
CBC Radio1 (Canada) maakte ook melding van dezelfde raketaanval op die militaire basis, echter daar sprak men niet over 30 kilometer van de Poolse grens maar over ‘kilometers van de Poolse grens’, ach ja dat klinkt een heel stuk sensationeler….. Het ging overigens om een militaire basis waar het Oekraïense leger ook oefende met NAVO-militairen…….
Gistermorgen op WDR 5 een tut van een rechtse Duitse denktank (betaald door de Duitse overheid), die verdedigde dat Duitsland een andere koers is ingeslagen met haar leger en een meer agressieve koers zal varen en dat niet alleen door het leveren van wapens aan landen in conflict gebieden, wat Duitsland overigens al veel vaker heeft gedaan, zoals aan genocidepleger Saoedi-Arabië, maar ook wil Duitsland nu een meer actieve rol binnen de NAVO gaan spelen….. Volgens deze figuur is dat belangrijk daar de kans bestaat dat Rusland ook Duitsland zal aanvallen……. ha! ha! ha! ha! ha! Wat betreft wapenhandel staat Duitsland er ook weer ‘goed op’: volgens SIPRI is Duitsland de nummer 5 exporteur van wapens……
Daarover gesproken: Nederland was volgens het SIPRI (overigens samen met Groot-Brittannië en Noorwegen) de grootste wapenimporteur in de periode van 2017 tot 2021, dit is volgens het Zweedse vredesinstituut te danken aan de spanningen met Rusland……. Spanningen die vooral door het westen werden en worden versterkt, zoals de NAVO oefeningen langs de westgrens van Rusland (waar ook Nederland met grote regelmaat aan meedoet)…….. De Russische inval in Oekraïne is dan ook volledig te danken aan de steeds verdere uitbreiding van de NAVO richting Moskou en de westerse agressie aan de westgrens van Rusland en langs haar territoriale wateren, waar de NAVO o.l.v. de VS bijna het jaarrond militaire oefeningen houdt, daarbij wordt zelfs geoefend op het binnenvallen van Russisch grondgebied……
Het westen wil ‘niet begrijpen’ (uiteraard begrijpt men het volgende wel) dat Rusland nog langer weigert om meer NAVO-lidstaten langs haar grens te tolereren, de afspraken in 1991 en 1992 waren dat de NAVO zich niet zou uitbreiden naar het oosten, daar had en heeft de NAVO lak aan, waarbij men even voorbij is gegaan aan het feit dat Rusland een nucleaire grootmacht is….. Als je een wereldmacht maar lang genoeg tart, zal deze uiteindelijk actie ondernemen en precies dat gebeurt nu in Oekraïne…… Vergeet niet dat de NAVO zoals gezegd al meerdere keren in Oekraïne aanwezig was om mee te doen aan militaire oefeningen, waarbij men ook daar oefende op het binnenvallen van Russisch grondgebied…… En dan durft men de NAVO een verdedigingsorganisatie te noemen, zelfs na oorlog te hebben gevoerd in voormalig Joegoslavië, Afghanistan, Irak, Libië, en Syrië, waarbij deze terreurorganisatie ook nog eens talloze grote oorlogsmisdaden heeft begaan……
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
Woensdag schreven de media
dat een kinderziekenhuis in de Zuid-Oekraïense havenstad Marioepol was
verwoest door Russische luchtaanvallen. Ze baseerden zich daarbij op een
onlinebericht van het stadsbestuur.
“De Russische bezetter heeft meerdere bommen op het kinderziekenhuis
gedropt. De verwoesting is enorm,” aldus het stadsbestuur. Er zouden 17
gewonden zijn gevallen onder het ziekenhuispersoneel. Reacties van
wereldleiders lieten niet lang op zich wachten. De Britse premier Boris
Johnson noemde de aanval ‘verdorven’.
Vrij snel na de aanval verschenen er haarscherpe, professionele
foto’s op internet van mensen die bij de aanval gewond zouden zijn
geraakt. Wat doe je als eerste nadat er raketten op een ziekenhuis
vallen? Je wacht natuurlijk totdat er een professionele fotograaf komt
opdraven om vast te leggen hoe je op een brancard wordt weggedragen.
Eruit gegooid
Er ging een aantal gebeurtenissen aan de aanval vooraf die de media
gemakshalve niet hebben benoemd, maar die wel van cruciaal belang zijn.
Twee dagen eerder, op maandag, had Rusland al gewaarschuwd
dat het ziekenhuis was omgetoverd tot militair object. Volgens lokale
berichten hebben Oekraïense troepen het personeel eruit gegooid, zo zei
de Russische VN-ambassadeur Vassily Nebenzia tijdens een briefing met de
VN-Veiligheidsraad over de humanitaire situatie in Oekraïne. Niemand luisterde naar hem.
Volgens de berichten hadden de Oekraïense troepen ook een
kleuterschool verwoest. Het ging om soldaten van het beruchte
Azovbataljon, dat in Marioepol is gevestigd.
Zoon van oud-medewerker
Op dinsdag verscheen er bovendien een artikel op de Russische nieuwssite Lenta.ru
waarin de zoon van een oud-medewerker van het ziekenhuis vertelt hoe
mannen in legeruniformen eind februari het kinderziekenhuis
binnendrongen. Iedereen moest vertrekken en de soldaten brachten wapens
naar binnen.
Sinds eind februari waren er volgens lokale bronnen dus geen
zorgmedewerkers en patiënten meer in het ziekenhuis, dat ook als
kraamkliniek fungeerde.
=======================================
* Niet zo vreemd als je bedenkt dat Oekraïne achter de schermen in feite wordt bestuurd door de VS. dat ook de opstand en staatsgreep tegen de democratisch gekozen president Janoekovytsj heeft georganiseerd, geregisseerd en bewezen betaald met 4 miljard dollar (het zou in werkelijkheid om 5 miljard dollar gaan)….. Daarna heeft de VS de zwaar corrupte neonazi Porosjenko als ‘interim president’ (lees: juntaleider) geïnstalleerd…… Alles in goede samenwerking met bestaande neonazi-groeperingen, die ook de controle kregen over de regering…… Daarna werden bepaalde politieke partijen verboden en werden journalisten en politici bedreigd dan wel vermoord……. En ja die neonazi geregeerde dictatuur wordt zwaar gesteund door het westen, ook met ons belastinggeld en wapens van ons leger…….
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar berichten over de oneindige VS terreur:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!! Vannacht (15 maart 2022/////) maakte CBC Radio1 bekend dat de uitlevering van Assange weer een stap dichterbij is gekomen >> de rechter heeft gesteld dat Julian Assange mensenlevens in gevaar heeft gebracht en dat dit een reden zou kunnen zijn tot uitlevering van Julian aan de grootste terreurentiteit ter wereld: de VS, terwijl deze leugen al lang en breed is doorgeprikt…….. SCHANDE!!!!
Voor meer missers van Jeroen de Jager, voer zijn naam in op het zoekvlak rechtsboven op deze pagina (onder de Google vertaalapp), daarna kan je nog kiezen voor sorteren op datum, direct boven het eerste bericht dat je te zien krijgt.
Bij de ongelofelijke hysterie over Oekraïne, dat zelf 8 jaar lang burgers bombardeerde zonder dat iemand uit de westerse politiek en reguliere media ook maar enige aandacht schonken aan de meer dan 13.000 mensen die daardoor het leven hebben verloren (ofwel die werden vermoord door neonazi-bataljons van het Oekraïense leger), wordt eens en te meer duidelijk dat ‘het gros van’ de neoliberaal geregeerde westerse landen zonder meer racistisch is, overduidelijk te zien aan de ruimhartige opvang van vluchtelingen uit Oekraïne……*
Het is om kotsmisselijk van te worden als je ziet wat een aandacht de westerse politiek en media besteden aan de vluchtelingen uit Oekraïne, terwijl het ze hoegenaamd niets kan schelen dat er de laatste 10 jaar zo’n 20.000 vluchtelingen zijn verdronken in de Middellandse Zee…. Ook het feit dat gekleurde buitenlandse studenten het vluchten uit Oekraïne onmogelijk werd gemaakt, interesseerde die media en politiek geen zier……. Nee, een dood jongetje deed de massa een paar jaar geleden even ontwaken uit de consucoma…… Zelfs EU reddingsoperaties werden zover uitgekleed dat het zeker was dat daardoor vluchtelingen zouden verdrinken….. ‘Geweldig’ hè de EU??!!!
En dan te bedenken dat de meeste van deze vluchtelingen, als die in Turkije en Griekenland (waar in de Egeïsche Zee ook nog eens een groot aantal mensen is verdronken, waaronder dat dode jongetje) op de vlucht zijn geslagen voor de illegale oorlogen die het westen o.l.v. de VS voerde in hun moederland (terreur van enorm grote schaal)…… Dan zijn er nog de vluchtelingen die vanwege de droogte zijn gevlucht en nog vluchten, mensen die in feite het slachtoffer waren en zijn van de vooral door westerse landen veroorzaakte snelle klimaatverandering…..
Ondanks dat een groot deel van de westerse landen verantwoordelijk is voor miljoenen vluchtelingen, wil men er amper of geen opnemen in eigen land, nee die mensen moeten in de regio worden opgevangen, terwijl die regio overvoerd zijn met vluchtelingen……
Nee, nu witte Oekraïners op de vlucht slaan, is er ineens plek genoeg voor de vluchtelingen, die meteen ook nog allemaal extra’s krijgen, extra’s die er niet zijn voor ‘normale vluchtelingen……’
Neoliberalisme is al een ideologie die dicht tegen fascisme aanschurkt, tel daarbij racisme op en je bent nog een hele stap verder richting een stinkende ‘nieuwe wereldorde…….’ Waar de belachelijke ongrondwettelijke, burger- en mensenrechtenschendende maatregelen tegen het Coronavirus hebben laten zien, dat de democratie op elk moment in de koelkast kan worden gezet, althans wat er nog rest van die democratie….. Ook de digitale EU pas, waarin al je gegevens komen te staan ook medische (en waarmee men je bankrekening kan blokkeren), is een verdere stap richting een fascistische regeerde staat…… Grote voorstanders van die pas: D66, VVD, CDA, PvdA en GroenLinks….. (zeker niet stemmen op deze partijen!!)
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
* Terwijl men nog onlangs vluchtelingen liet doodvriezen voor de Poolse grens en zelfs op Pools grondgebied……..
Via het Linkedin account van Mario Ortiz Martinez vond ik de volgende productie waarin wordt uitgelegd dat het Pfizer vaccin het DNA van de lever aantast. Voorts wordt de Neurenberg Code aangehaald, waarin duidelijk is weergegeven dat het iedereen vrij moet staan om wel dan niet te kiezen voor een vaccinatie en gezien de tekst zit daar geen woord Spaans bij (overigens heeft de EU eerder laten weten tegen verpolichte vaccinatie te zijn, al is die mening intussen losgelaten door hare kwaadaardigheid von der Leyen, althans als ik me niet vergis):
“1. The voluntary consent of the human subject is absolutely essential.This means that the person involved should have legal capacity to give consent; should be so situated as to be able to exercise free power of choice, without the intervention of any element of force, fraud, deceit, duress, over-reaching, or other ulterior form of constraint or coercion.”
Deze tekst kom je hieronder nogmaals tegen en gezien de volledige tekst is het m.i. onverantwoord om je te laten vaccineren met het Pfizer vaccin. Maar lees de tekst en vorm je eigen oordeel. (zie alvorens tot vaccinatie over te gaan ook de berichten onder de door mij toegevoegde links en ook daarbij: vorm je eigen mening)
(On the top right hand side of this page you can choose for a translation in the language of your choice: choose ‘Engels’ [english] so you can recognise your own language [the Google translation is first in dutch, a language most people don’t understand, while on the other hand most people recognise there language translated in english])
(als je het Engels niet machtig bent, kopieer dan de Engelse tekst en plak die in deze vertaalapp, de app werkt snel en de vertaling is van een redelijk goede kwaliteit. Kopieer het artikel en plaats het links in de app, je ziet rechts Italiaans staan als je daar op klikt kan je kiezen voor Nederlands)
Preclinical studies of COVID-19 mRNA vaccine BNT162b2, developed by Pfizer and BioNTech, showed reversible hepatic effects in animals that received the BNT162b2 injection. Furthermore, a recent study showed that SARS-CoV-2 RNA can be reverse-transcribed and integrated into the genome of human cells. In this study, we investigated the effect of BNT162b2 on the human liver cell line Huh7 in vitro. Huh7 cells were exposed to BNT162b2, and quantitative PCR was performed on RNA extracted from the cells. We detected high levels of BNT162b2 in Huh7 cells and changes in gene expression of long interspersed nuclear element-1 (LINE-1), which is an endogenous reverse transcriptase. Immunohistochemistry using antibody binding to LINE-1 open reading frame-1 RNA-binding protein (ORFp1) on Huh7 cells treated with BNT162b2 indicated increased nucleus distribution of LINE-1. PCR on genomic DNA of Huh7 cells exposed to BNT162b2 amplified the DNA sequence unique to BNT162b2. Our results indicate a fast up-take of BNT162b2 into human liver cell line Huh7, leading to changes in LINE-1 expression and distribution. We also show that BNT162b2 mRNA is reverse transcribed intracellularly into DNA in as fast as 6 h upon BNT162b2 exposure.
Coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was announced by the World Health Organization (WHO) as a global pandemic on 11 March 2020, and it emerged as a devasting health crisis. As of February 2022, COVID-19 has led to over 430 million reported infection cases and 5.9 million deaths worldwide [1]. Effective and safe vaccines are urgently needed to reduce the morbidity and mortality rates associated with COVID-19.
Several vaccines for COVID-19 have been developed, with particular focus on mRNA vaccines (by Pfizer-BioNTech and Moderna), replication-defective recombinant adenoviral vector vaccines (by Janssen-Johnson and Johnson, Astra-Zeneca, Sputnik-V, and CanSino), and inactivated vaccines (by Sinopharm, Bharat Biotech and Sinovac). The mRNA vaccine has the advantages of being flexible and efficient in immunogen design and manufacturing, and currently, numerous vaccine candidates are in various stages of development and application. Specifically, COVID-19 mRNA vaccine BNT162b2 developed by Pfizer and BioNTech has been evaluated in successful clinical trials [2,3,4] and administered in national COVID-19 vaccination campaigns in different regions around the world [5,6,7,8].
BNT162b2 is a lipid nanoparticle (LNP)–encapsulated, nucleoside-modified RNA vaccine (modRNA) and encodes the full-length of SARS-CoV-2 spike (S) protein, modified by two proline mutations to ensure antigenically optimal pre-fusion conformation, which mimics the intact virus to elicit virus-neutralizing antibodies [3]. Consistent with randomized clinical trials, BNT162b2 showed high efficiency in a wide range of COVID-19-related outcomes in a real-world setting [5]. Nevertheless, many challenges remain, including monitoring for long-term safety and efficacy of the vaccine. This warrants further evaluation and investigations. The safety profile of BNT162b2 is currently only available from short-term clinical studies. Less common adverse effects of BNT162b2 have been reported, including pericarditis, arrhythmia, deep-vein thrombosis, pulmonary embolism, myocardial infarction, intracranial hemorrhage, and thrombocytopenia [4,9,10,11,12,13,14,15,16,17,18,19,20]. There are also studies that report adverse effects observed in other types of vaccines [21,22,23,24]. To better understand mechanisms underlying vaccine-related adverse effects, clinical investigations as well as cellular and molecular analyses are needed.
A recent study showed that SARS-CoV-2 RNAs can be reverse-transcribed and integrated into the genome of human cells [25]. This gives rise to the question of if this may also occur with BNT162b2, which encodes partial SARS-CoV-2 RNA. In pharmacokinetics data provided by Pfizer to European Medicines Agency (EMA), BNT162b2 biodistribution was studied in mice and rats by intra-muscular injection with radiolabeled LNP and luciferase modRNA. Radioactivity was detected in most tissues from the first time point (0.25 h), and results showed that the injection site and the liver were the major sites of distribution, with maximum concentrations observed at 8–48 h post-dose [26]. Furthermore, in animals that received the BNT162b2 injection, reversible hepatic effects were observed, including enlarged liver, vacuolation, increased gamma glutamyl transferase (γGT) levels, and increased levels of aspartate transaminase (AST) and alkaline phosphatase (ALP) [26]. Transient hepatic effects induced by LNP delivery systems have been reported previously [27,28,29,30], nevertheless, it has also been shown that the empty LNP without modRNA alone does not introduce any significant liver injury [27]. Therefore, in this study, we aim to examine the effect of BNT162b2 on a human liver cell line in vitro and investigate if BNT162b2 can be reverse transcribed into DNA through endogenous mechanisms.
2. Materials and Methods
2.1. Cell Culture
Huh7 cells (JCRB Cell Bank, Osaka, Japan) were cultured in 37 °C at 5% CO2 with DMEM medium (HyClone, HYCLSH30243.01) supplemented with 10% (v/v) fetal bovine serum (Sigma-Aldrich, F7524-500ML, Burlington, MA, USA) and 1% (v/v) Penicillin-Streptomycin (HyClone, SV30010, Logan, UT, USA). For BNT162b2 treatment, Huh7 cells were seeded with a density of 200,000 cells/well in 24-well plates. BNT162b2 mRNA vaccine (Pfizer BioNTech, New York, NY, USA) was diluted with sterile 0.9% sodium chloride injection, USP into a final concentration of 100 μg/mL as described in the manufacturer’s guideline [31]. BNT162b2 suspension was then added in cell culture media to reach final concentrations of 0.5, 1.0, or 2.0 μg/mL. Huh7 cells were incubated with or without BNT162b2 for 6, 24, and 48 h. Cells were washed thoroughly with PBS and harvested by trypsinization and stored in −80 °C until further use.
2.2. REAL-TIME RT-QPCR
RNA from the cells was extracted with RNeasy Plus Mini Kit (Qiagen, 74134, Hilden, Germany) following the manufacturer’s protocol. RT-PCR was performed using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, K1622, Waltham, MA, USA) following the manufacturers protocol. Real-time qPCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, K0222, Waltham, MA, USA) with primers for BNT162b2, LINE-1 and housekeeping genes ACTB and GAPDH (Table 1).
Table 1. Primer sequences of RT-qPCR and PCR.
Table 1. Primer sequences of RT-qPCR and PCR.
Target
Sequence
ACTB forward
CCTCGCCTTTGCCGATCC
ACTB reverse
GGATCTTCATGAGGTAGTCAGTC
GAPDH forward
CTCTGCTCCTCCTGTTCGAC
GAPDH reverse
TTAAAAGCAGCCCTGGTGAC
LINE-1 forward
TAACCAATACAGAGAAGTGC
LINE-1 reverse
GATAATATCCTGCAGAGTGT
BNT162b2 forward
CGAGGTGGCCAAGAATCTGA
BNT162b2 reverse
TAGGCTAAGCGTTTTGAGCTG
2.3. Immunofluorescence Staining and Confocal Imaging
Huh7 cells were cultured in eight-chamber slides (LAB-TEK, 154534, Santa Cruz, CA, USA) with a density of 40,000 cells/well, with or without BNT162b2 (0.5, 1 or 2 µg/mL) for 6 h. Immunohistochemistry was performed using primary antibody anti-LINE-1 ORF1p mouse monoclonal antibody (Merck, 3574308, Kenilworth, NJ, USA), secondary antibody Cy3 Donkey anti-mouse (Jackson ImmunoResearch, West Grove, PA, USA), and Hoechst (Life technologies, 34850, Carlsbad, CA, USA), following the protocol from Thermo Fisher (Waltham, MA, USA). Two images per condition were taken using a Zeiss LSM 800 and a 63X oil immersion objective, and the staining intensity was quantified on the individual whole cell area and the nucleus area on 15 cells per image by ImageJ 1.53c. LINE-1 staining intensity for the cytosol was calculated by subtracting the intensity of the nucleus from that of the whole cell. All images of the cells were assigned a random number to prevent bias. To mark the nuclei (determined by the Hoechst staining) and the whole cells (determined by the borders of the LINE-1 fluorescence), the Freehand selection tool was used. These areas were then measured, and the mean intensity was used to compare the groups.
2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and Sanger Sequencing
Genomic DNA was extracted from cell pellets with PBND buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20) according to protocol described previously [32]. To remove residual RNA from the DNA preparation, RNase (100 µg/mL, Qiagen, Hilden, Germany) was added to the DNA preparation and incubated at 37 °C for 3 h, followed by 5 min at 95 °C. PCR was then performed using primers targeting BNT162b2 (sequences are shown in Table 1), with the following program: 5 min at 95 °C, 35 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min; finally, 72 °C for 5 min and 12 °C for 5 min. PCR products were run on 1.4% (w/v) agarose gel. Bands corresponding to the amplicons of the expected size (444 bps) were cut out and DNA was extracted using QIAquick PCR Purification Kit (Qiagen, 28104, Hilden, Germany), following the manufacturer’s instructions. The sequence of the DNA amplicon was verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany).
Statistics
Statistical comparisons were performed using two-tailed Student’s t-test and ANOVA. Data are expressed as the mean ± SEM or ± SD. Differences with p < 0.05 are considered significant.
2.5. Ethical Statements
The Huh7 cell line was obtained from Japanese Collection of Research Bioresources (JCRB) Cell Bank.
3. Results
3.1. BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency
To determine if BNT162b2 enters human liver cells, we exposed human liver cell line Huh7 to BNT162b2. In a previous study on the uptake kinetics of LNP delivery in Huh7 cells, the maximum biological efficacy of LNP was observed between 4–7 h [33]. Therefore, in our study, Huh7 cells were cultured with or without increasing concentrations of BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6, 24, and 48 h. RNA was extracted from cells and a real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) was performed using primers targeting the BNT162b2 sequence, as illustrated in Figure 1. The full sequence of BNT162b2 is publicly available [34] and contains a two-nucleotides cap; 5′- untranslated region (UTR) that incorporates the 5′ -UTR of a human α-globin gene; the full-length of SARS-CoV-2 S protein with two proline mutations; 3′-UTR that incorporates the human mitochondrial 12S rRNA (mtRNR1) segment and human AES/TLE5 gene segment with two C→U mutations; poly(A) tail. Detailed analysis of the S protein sequence in BNT162b2 revealed 124 sequences that are 100% identical to human genomic sequences and three sequences with only one nucleotide (nt) mismatch in 19–26 nts (Table S1, see Supplementary Materials). To detect BNT162b2 RNA level, we designed primers with forward primer located in SARS-CoV-2 S protein regions and reverse primer in 3′-UTR, which allows detection of PCR amplicon unique to BNT162b2 without unspecific binding of the primers to human genomic regions.
Figure 1. PCR primer set used to detect mRNA level and reverse-transcription of BNT162b2. Illustration of BNT162b2 was adapted from previously described literature [34].
RT-qPCR results showed that Huh7 cells treated with BNT162b2 had high levels of BNT162b2 mRNA relative to housekeeping genes at 6, 24, and 48 h (Figure 2, presented in logged 2−ΔΔCT due to exceptionally high levels). The three BNT162b2 concentrations led to similar intracellular BNT162b2 mRNA levels at the different time points, except that the significant difference between 1.0 and 2.0 µg/mL was observed at 48 h. BNT162b2 mRNA levels were significantly decreased at 24 h compared to 6 h, but increased again at 48 h.
Figure 2. BNT162b2 mRNA levels in Huh7 cells treated with BNT162b2. Huh7 cells were treated without (Ctrl) or with 0.5 (V1), 1 (V2), and 2 µg/mL (V3) of BNT162b2 for 6 (green dots), 24 (orange dots), and 48 h (blue dots). RNA was purified and qPCR was performed using primers targeting BNT162b2. RNA levels of BNT162b2 are presented as logged 2−ΔΔCT values relative to house-keeping genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated).
3.2. Effect of BNT162b2 on Human Endogenous Reverse Transcriptase Long Interspersed Nuclear Element-1 (LINE-1)
Here we examined the effect of BNT162b2 on LINE-1 gene expression. RT-qPCR was performed on RNA purified from Huh7 cells treated with BNT162b2 (0, 0.5, 1.0, and 2.0 µg/mL) for 6, 24, and 48 h, using primers targeting LINE-1. Significantly increased LINE-1 expression compared to control was observed at 6 h by 2.0 µg/mL BNT162b2, while lower BNT162b2 concentrations decreased LINE-1 expression at all time points (Figure 3).
Figure 3.LINE-1 mRNA levels in Huh7 cells treated with BNT162b2. Huh7 cells were treated without (Ctrl) or with 0.5 (V1), 1 (V2), and 2 µg/mL (V3) of BNT162b2 for 6 (green dots), 24 (red dots), and 48 h (blue dots). RNA was purified and qPCR was performed using primers targeting LINE-1. RNA levels of LINE-1 are presented as 2−ΔΔCT values relative to house-keeping genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated; † p < 0.05 vs. 6 h-Ctrl).
Next, we studied the effect of BNT162b2 on LINE-1 protein level. The full-length LINE-1 consists of a 5′ untranslated region (UTR), two open reading frames (ORFs), ORF1 and ORF2, and a 3′UTR, of which ORF1 is an RNA binding protein with chaperone activity. The retrotransposition activity of LINE-1 has been demonstrated to involve ORF1 translocation to the nucleus [35]. Huh7 cells treated with or without BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6 h were fixed and stained with antibodies binding to LINE-1 ORF1p, and DNA-specific probe Hoechst for visualization of cell nucleus (Figure 4a). Quantification of immunofluorescence staining intensity showed that BNT162b2 increased LINE-1 ORF1p protein levels in both the whole cell area and nucleus at all concentrations tested (Figure 4b–d).
Figure 4. Immunohistochemistry of Huh7 cells treated with BNT162b2 on LINE-1 protein distribution. Huh7 cells were treated without (Ctrl) or with 0.5, 1, and 2 µg/mL of BNT162b2 for 6 h. Cells were fixed and stained with antibodies binding to LINE-1 ORF1p (red) and DNA-specific probe Hoechst for visualization of cell nucleus (blue). (a) Representative images of LINE-1 expression in Huh7 cells treated with or without BNT162b2. (b–d) Quantification of LINE-1 protein in whole cell area (b), cytosol (c), and nucleus (d). All data were analyzed using One-Way ANOVA, and graphs were created using GraphPad Prism V 9.2. All data is presented as mean ± SD (** p < 0.01; *** p < 0.001; **** p < 0.0001 as indicated).
3.3. Detection of Reverse Transcribed BNT162b2 DNA in Huh7 Cells
A previous study has shown that entry of LINE-1 protein into the nucleus is associated with retrotransposition [35]. In the immunofluorescence staining experiment described above, increased levels of LINE-1 in the nucleus were observed already at the lowest concentration of BNT162b2 (0.5 µg/mL). To examine if BNT162b2 is reversely transcribed into DNA when LINE-1 is elevated, we purified genomic DNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2 for 6, 24, and 48 h. Purified DNA was treated with RNase to remove RNA and subjected to PCR using primers targeting BNT162b2, as illustrated in Figure 1. Amplified DNA fragments were then visualized by electrophoresis and gel-purified (Figure 5). BNT162b2 DNA amplicons were detected in all three time points (6, 24, and 48 h). Sanger sequencing confirmed that the DNA amplicons were identical to the BNT162b2 sequence flanked by the primers (Table 2). To ensure that the DNA amplicons were derived from DNA but not BNT162b2 RNA, we also performed PCR on RNA purified from Huh7 cells treated with 0.5 µg/mL BNT162b2 for 6 h, with or without RNase treatment (Ctrl 5 and 6 in Figure 5), and no amplicon was detected in the RNA samples subjected to PCR.
Figure 5. Detection of DNA amplicons of BNT162b2 in Huh7 cells treated with BNT162b2. Huh7 cells were treated without (Ctrl) or with 0.5 µg/mL of BNT162b2 for 6, 24, and 48 h. Genomic DNA was purified and digested with 100 µg/mL RNase. PCR was run on all samples with primers targeting BNT162b2, as shown in Figure 1 and Table 1. DNA amplicons (444 bps) were visualized on agarose gel. BNT: BNT162b2; L: DNA ladder; Ctrl1: cultured Huh7 cells; Ctrl2: Huh7 cells without BNT162b2 treatment collected at 6 h; Ctrl3: Huh7 cells without BNT162b2 treatment collected at 24 h; Ctrl4: Huh7 cells without BNT162b2 treatment collected at 48 h; Ctrl5: RNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2 for 6 h; Ctrl6: RNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2 for 6 h, digested with RNase.
Table 2. Sanger sequencing result of the BNT162b2 amplicon.
Table 2. Sanger sequencing result of the BNT162b2 amplicon.
In this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is able to enter the human liver cell line Huh7 in vitro. BNT162b2 mRNA is reverse transcribed intracellularly into DNA as fast as 6 h after BNT162b2 exposure. A possible mechanism for reverse transcription is through endogenous reverse transcriptase LINE-1, and the nucleus protein distribution of LINE-1 is elevated by BNT162b2.
Intracellular accumulation of LNP in hepatocytes has been demonstrated in vivo [36]. A preclinical study on BNT162b2 showed that BNT162b2 enters the human cell line HEK293T cells and leads to robust expression of BNT162b2 antigen [37]. Therefore, in this study, we first investigated the entry of BNT162b2 in the human liver cell line Huh7 cells. The choice of BNT162b2 concentrations used in this study warrants explanation. BNT162b2 is administered as a series of two doses three weeks apart, and each dose contains 30 µg of BNT162b2 in a volume of 0.3 mL, which makes the local concentration at the injection site at the highest 100 µg/mL [31]. A previous study on mRNA vaccines against H10N8 and H7N9 influenza viruses using a similar LNP delivery system showed that the mRNA vaccine can distribute rather nonspecifically to several organs such as liver, spleen, heart, kidney, lung, and brain, and the concentration in the liver is roughly 100 times lower than that of the intra-muscular injection site [38]. In the assessment report on BNT162b2 provided to EMA by Pfizer, the pharmacokinetic distribution studies in rats demonstrated that a relatively large proportion (up to 18%) of the total dose distributes to the liver [26]. We therefore chose to use 0.5, 1, and 2 μg/mL of vaccine in our experiments on the liver cells. However, the effect of a broader range of lower and higher concentrations of BNT162b2 should also be verified in future studies.
In the current study, we employed a human liver cell line for in vitro investigation. It is worth investigating if the liver cells also present the vaccine-derived SARS-CoV-2 spike protein, which could potentially make the liver cells targets for previously primed spike protein reactive cytotoxic T cells. There has been case reports on individuals who developed autoimmune hepatitis [39] after BNT162b2 vaccination. To obtain better understanding of the potential effects of BNT162b2 on liver function, in vivo models are desired for future studies.
In the BNT162b2 toxicity report, no genotoxicity nor carcinogenicity studies have been provided [26]. Our study shows that BNT162b2 can be reverse transcribed to DNA in liver cell line Huh7, and this may give rise to the concern if BNT162b2-derived DNA may be integrated into the host genome and affect the integrity of genomic DNA, which may potentially mediate genotoxic side effects. At this stage, we do not know if DNA reverse transcribed from BNT162b2 is integrated into the cell genome. Further studies are needed to demonstrate the effect of BNT162b2 on genomic integrity, including whole genome sequencing of cells exposed to BNT162b2, as well as tissues from human subjects who received BNT162b2 vaccination.
Human autonomous retrotransposon LINE-1 is a cellular endogenous reverse transcriptase and the only remaining active transposon in humans, able to retrotranspose itself and other nonautonomous elements [40,41], and ~17% of the human genome are comprised of LINE-1 sequences [42]. The nonautonomous Alu elements, short, interspersed nucleotide elements (SINEs), variable-number-of-tandem-repeats (VNTR), as well as cellular mRNA-processed pseudogenes, are retrotransposed by the LINE-1 retrotransposition proteins working in trans [43,44]. A recent study showed that endogenous LINE-1 mediates reverse transcription and integration of SARS-CoV-2 sequences in the genomes of infected human cells [25]. Furthermore, expression of endogenous LINE-1 is often increased upon viral infection, including SARS-CoV-2 infection [45,46,47]. Previous studies showed that LINE-1 retrotransposition activity is regulated by RNA metabolism [48,49], DNA damage response [50], and autophagy [51]. Efficient retrotransposition of LINE-1 is often associated with cell cycle and nuclear envelope breakdown during mitosis [52,53], as well as exogenous retroviruses [54,55], which promotes entrance of LINE-1 into the nucleus. In our study, we observed increased LINE-1 ORF1p distribution as determined by immunohistochemistry in the nucleus by BNT162b2 at all concentrations tested (0.5, 1, and 2 μg/mL), while elevated LINE-1 gene expression was detected at the highest BNT162b2 concentration (2 μg/mL). It is worth noting that gene transcription is regulated by chromatin modifications, transcription factor regulation, and the rate of RNA degradation, while translational regulation of protein involves ribosome recruitment on the initiation codon, modulation of peptide elongation, termination of protein synthesis, or ribosome biogenesis. These two processes are controlled by different mechanisms, and therefore they may not always show the same change patterns in response to external challenges. The exact regulation of LINE-1 activity in response to BNT162b2 merits further study.
The cell model that we used in this study is a carcinoma cell line, with active DNA replication which differs from non-dividing somatic cells. It has also been shown that Huh7 cells display significant different gene and protein expression including upregulated proteins involved in RNA metabolism [56]. However, cell proliferation is also active in several human tissues such as the bone marrow or basal layers of epithelia as well as during embryogenesis, and it is therefore necessary to examine the effect of BNT162b2 on genomic integrity under such conditions. Furthermore, effective retrotransposition of LINE-1 has also been reported in non-dividing and terminally differentiated cells, such as human neurons [57,58].
The Pfizer EMA assessment report also showed that BNT162b2 distributes in the spleen (<1.1%), adrenal glands (<0.1%), as well as low and measurable radioactivity in the ovaries and testes (<0.1%) [26]. Furthermore, no data on placental transfer of BNT162b2 is available from Pfizer EMA assessment report. Our results showed that BNT162b2 mRNA readily enters Huh7 cells at a concentration (0.5 µg/mL) corresponding to 0.5% of the local injection site concentration, induce changes in LINE-1 gene and protein expression, and within 6 h, reverse transcription of BNT162b2 can be detected. It is therefore important to investigate further the effect of BNT162b2 on other cell types and tissues both in vitro and in vivo.
5. Conclusions
Our study is the first in vitro study on the effect of COVID-19 mRNA vaccine BNT162b2 on human liver cell line. We present evidence on fast entry of BNT162b2 into the cells and subsequent intracellular reverse transcription of BNT162b2 mRNA into DNA.
M.A., F.O.F., D.Y., M.B. and C.L. performed in vitro experiments. M.A. and F.O.F. performed data analysis. M.R. and Y.D.M. contributed to the implementation of the research, designed, and supervised the study. Y.D.M. wrote the paper with input from all authors. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by the Swedish Research Council (SRC), Strategic Research Area Exodiab, Dnr 2009-1039, the Swedish Government Fund for Clinical Research (ALF) and the foundation of Skåne University Hospital.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All data supporting the findings of this study are available within the article and supporting information.
Acknowledgments
The authors thank Sven Haidl, Maria Josephson, Enming Zhang, Jia-Yi Li, Caroline Haikal, and Pradeep Bompada for their support to this study.
Conflicts of Interest
The authors declare no conflict of interest.
References
World Health Organization. Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on 22 February 2022).
Mulligan, M.J.; Lyke, K.E.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Raabe, V.; Bailey, R.; Swanson, K.A.; et al. Phase I/II study of COVID-19 RNA vaccine BNT162b1 in adults. Nature2020, 586, 589–593. [Google Scholar] [CrossRef] [PubMed]
Walsh, E.E.; Frenck, R.W., Jr.; Falsey, A.R.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Mulligan, M.J.; Bailey, R.; et al. Safety and Immunogenicity of Two RNA-Based COVID-19 Vaccine Candidates. N. Engl. J. Med.2020, 383, 2439–2450. [Google Scholar] [CrossRef] [PubMed]
Polack, F.P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Perez, J.L.; Perez Marc, G.; Moreira, E.D.; Zerbini, C.; et al. Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine. N. Engl. J. Med.2020, 383, 2603–2615. [Google Scholar] [CrossRef] [PubMed]
Harris, R.J.; Hall, J.A.; Zaidi, A.; Andrews, N.J.; Dunbar, J.K.; Dabrera, G. Effect of Vaccination on Household Transmission of SARS-CoV-2 in England. N. Engl. J. Med.2021, 385, 759–760. [Google Scholar] [CrossRef]
Butt, A.A.; Omer, S.B.; Yan, P.; Shaikh, O.S.; Mayr, F.B. SARS-CoV-2 Vaccine Effectiveness in a High-Risk National Population in a Real-World Setting. Ann. Intern. Med.2021, 174, 1404–1408. [Google Scholar] [CrossRef]
Dagan, N.; Barda, N.; Kepten, E.; Miron, O.; Perchik, S.; Katz, M.A.; Hernan, M.A.; Lipsitch, M.; Reis, B.; Balicer, R.D. BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Mass Vaccination Setting. N. Engl. J. Med.2021, 384, 1412–1423. [Google Scholar] [CrossRef]
Rossman, H.; Shilo, S.; Meir, T.; Gorfine, M.; Shalit, U.; Segal, E. COVID-19 dynamics after a national immunization program in Israel. Nat. Med.2021, 27, 1055–1061. [Google Scholar] [CrossRef]
Fan, B.E.; Shen, J.Y.; Lim, X.R.; Tu, T.M.; Chang, C.C.R.; Khin, H.S.W.; Koh, J.S.; Rao, J.P.; Lau, S.L.; Tan, G.B.; et al. Cerebral venous thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: A black swan event. Am. J. Hematol.2021, 96, E357–E361. [Google Scholar] [CrossRef]
Menni, C.; Klaser, K.; May, A.; Polidori, L.; Capdevila, J.; Louca, P.; Sudre, C.H.; Nguyen, L.H.; Drew, D.A.; Merino, J.; et al. Vaccine side-effects and SARS-CoV-2 infection after vaccination in users of the COVID Symptom Study app in the UK: A prospective observational study. Lancet Infect. Dis.2021, 21, 939–949. [Google Scholar] [CrossRef]
Hansen, T.; Titze, U.; Kulamadayil-Heidenreich, N.S.A.; Glombitza, S.; Tebbe, J.J.; Rocken, C.; Schulz, B.; Weise, M.; Wilkens, L. First case of postmortem study in a patient vaccinated against SARS-CoV-2. Int. J. Infect. Dis.2021, 107, 172–175. [Google Scholar] [CrossRef] [PubMed]
Kadali, R.A.K.; Janagama, R.; Peruru, S.; Malayala, S.V. Side effects of BNT162b2 mRNA COVID-19 vaccine: A randomized, cross-sectional study with detailed self-reported symptoms from healthcare workers. Int. J. Infect. Dis.2021, 106, 376–381. [Google Scholar] [CrossRef] [PubMed]
Parkash, O.; Sharko, A.; Farooqi, A.; Ying, G.W.; Sura, P. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine. Cureus2021, 13, e14741. [Google Scholar] [CrossRef] [PubMed]
Mazzatenta, C.; Piccolo, V.; Pace, G.; Romano, I.; Argenziano, G.; Bassi, A. Purpuric lesions on the eyelids developed after BNT162b2 mRNA COVID-19 vaccine: Another piece of SARS-CoV-2 skin puzzle? J. Eur. Acad. Dermatol. Venereol.2021, 35, e543–e545. [Google Scholar] [CrossRef]
Lee, E.J.; Cines, D.B.; Gernsheimer, T.; Kessler, C.; Michel, M.; Tarantino, M.D.; Semple, J.W.; Arnold, D.M.; Godeau, B.; Lambert, M.P.; et al. Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol.2021, 96, 534–537. [Google Scholar] [CrossRef]
Das, B.B.; Kohli, U.; Ramachandran, P.; Nguyen, H.H.; Greil, G.; Hussain, T.; Tandon, A.; Kane, C.; Avula, S.; Duru, C.; et al. Myopericarditis following mRNA COVID-19 Vaccination in Adolescents 12 through 18 Years of Age. J. Pediatr.2021, 238, 26–32.e1. [Google Scholar] [CrossRef]
McLaurin-Jiang, S.; Garner, C.D.; Krutsch, K.; Hale, T.W. Maternal and Child Symptoms Following COVID-19 Vaccination Among Breastfeeding Mothers. Breastfeed. Med.2021, 16, 702–709. [Google Scholar] [CrossRef]
Barda, N.; Dagan, N.; Ben-Shlomo, Y.; Kepten, E.; Waxman, J.; Ohana, R.; Hernan, M.A.; Lipsitch, M.; Kohane, I.; Netzer, D.; et al. Safety of the BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Setting. N. Engl. J. Med.2021, 385, 1078–1090. [Google Scholar] [CrossRef]
Baden, L.R.; El Sahly, H.M.; Essink, B.; Kotloff, K.; Frey, S.; Novak, R.; Diemert, D.; Spector, S.A.; Rouphael, N.; Creech, C.B.; et al. Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med.2021, 384, 403–416. [Google Scholar] [CrossRef]
Sadoff, J.; Gray, G.; Vandebosch, A.; Cardenas, V.; Shukarev, G.; Grinsztejn, B.; Goepfert, P.A.; Truyers, C.; Fennema, H.; Spiessens, B.; et al. Safety and Efficacy of Single-Dose Ad26.COV2.S Vaccine against Covid-19. N. Engl. J. Med.2021, 384, 2187–2201. [Google Scholar] [CrossRef] [PubMed]
Eichinger, S.; Warkentin, T.E.; Greinacher, A. Thrombotic Thrombocytopenia after ChAdOx1 nCoV-19 Vaccination. Reply. N. Engl. J. Med.2021, 385, e11. [Google Scholar] [CrossRef] [PubMed]
Doroftei, B.; Ciobica, A.; Ilie, O.D.; Maftei, R.; Ilea, C. Mini-Review Discussing the Reliability and Efficiency of COVID-19 Vaccines. Diagnostics2021, 11, 579. [Google Scholar] [CrossRef]
Zhang, L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch, R. Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA2021, 118, e2105968118. [Google Scholar] [CrossRef] [PubMed]
Tanaka, H.; Takata, N.; Sakurai, Y.; Yoshida, T.; Inoue, T.; Tamagawa, S.; Nakai, Y.; Tange, K.; Yoshioka, H.; Maeki, M.; et al. Delivery of Oligonucleotides Using a Self-Degradable Lipid-Like Material. Pharmaceutics2021, 13, 544. [Google Scholar] [CrossRef]
Sedic, M.; Senn, J.J.; Lynn, A.; Laska, M.; Smith, M.; Platz, S.J.; Bolen, J.; Hoge, S.; Bulychev, A.; Jacquinet, E.; et al. Safety Evaluation of Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat and Cynomolgus Monkey. Vet. Pathol.2018, 55, 341–354. [Google Scholar] [CrossRef]
Sato, Y.; Matsui, H.; Yamamoto, N.; Sato, R.; Munakata, T.; Kohara, M.; Harashima, H. Highly specific delivery of siRNA to hepatocytes circumvents endothelial cell-mediated lipid nanoparticle-associated toxicity leading to the safe and efficacious decrease in the hepatitis B virus. J. Control. Release2017, 266, 216–225. [Google Scholar] [CrossRef]
Gallud, A.; Munson, M.J.; Liu, K.; Idstrom, A.; Barriga, H.M.; Tabaei, S.; Aliakbarinodehi, N.; Ojansivu, M.; Lubart, Q.; Doutch, J.J.; et al. Time evolution of PEG-shedding and serum protein coronation determines the cell uptake kinetics and delivery of lipid nanoparticle. bioRxiv2021. [Google Scholar] [CrossRef]
Mita, P.; Wudzinska, A.; Sun, X.; Andrade, J.; Nayak, S.; Kahler, D.J.; Badri, S.; LaCava, J.; Ueberheide, B.; Yun, C.Y.; et al. LINE-1 protein localization and functional dynamics during the cell cycle. Elife2018, 7, e30058. [Google Scholar] [CrossRef]
Sato, Y.; Kinami, Y.; Hashiba, K.; Harashima, H. Different kinetics for the hepatic uptake of lipid nanoparticles between the apolipoprotein E/low density lipoprotein receptor and the N-acetyl-d-galactosamine/asialoglycoprotein receptor pathway. J. Control. Release2020, 322, 217–226. [Google Scholar] [CrossRef]
Vogel, A.B.; Kanevsky, I.; Che, Y.; Swanson, K.A.; Muik, A.; Vormehr, M.; Kranz, L.M.; Walzer, K.C.; Hein, S.; Guler, A.; et al. BNT162b vaccines protect rhesus macaques from SARS-CoV-2. Nature2021, 592, 283–289. [Google Scholar] [CrossRef] [PubMed]
Bahl, K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.; Laska, M.E.; Smith, M.; Almarsson, O.; Thompson, J.; et al. Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses. Mol. Ther.2017, 25, 1316–1327. [Google Scholar] [CrossRef] [PubMed]
Bril, F.; Al Diffalha, S.; Dean, M.; Fettig, D.M. Autoimmune hepatitis developing after coronavirus disease 2019 (COVID-19) vaccine: Causality or casualty? J. Hepatol.2021, 75, 222–224. [Google Scholar] [CrossRef]
Kazazian, H.H., Jr.; Moran, J.V. Mobile DNA in Health and Disease. N. Engl. J. Med.2017, 377, 361–370. [Google Scholar] [CrossRef] [PubMed]
Coffin, J.M.; Fan, H. The Discovery of Reverse Transcriptase. Annu. Rev. Virol.2016, 3, 29–51. [Google Scholar] [CrossRef]
Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al. Initial sequencing and analysis of the human genome. Nature2001, 409, 860–921. [Google Scholar] [CrossRef]
Ostertag, E.M.; Goodier, J.L.; Zhang, Y.; Kazazian, H.H., Jr. SVA elements are nonautonomous retrotransposons that cause disease in humans. Am. J. Hum. Genet.2003, 73, 1444–1451. [Google Scholar] [CrossRef]
Hancks, D.C.; Kazazian, H.H., Jr. Active human retrotransposons: Variation and disease. Curr. Opin. Genet. Dev.2012, 22, 191–203. [Google Scholar] [CrossRef]
Jones, R.B.; Song, H.; Xu, Y.; Garrison, K.E.; Buzdin, A.A.; Anwar, N.; Hunter, D.V.; Mujib, S.; Mihajlovic, V.; Martin, E.; et al. LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells. J. Virol.2013, 87, 13307–13320. [Google Scholar] [CrossRef]
Macchietto, M.G.; Langlois, R.A.; Shen, S.S. Virus-induced transposable element expression up-regulation in human and mouse host cells. Life Sci. Alliance2020, 3, e201900536. [Google Scholar] [CrossRef] [PubMed]
Yin, Y.; Liu, X.Z.; He, X.; Zhou, L.Q. Exogenous Coronavirus Interacts With Endogenous Retrotransposon in Human Cells. Front. Cell Infect. Microbiol.2021, 11, 609160. [Google Scholar] [CrossRef] [PubMed]
Belancio, V.P.; Roy-Engel, A.M.; Deininger, P. The impact of multiple splice sites in human L1 elements. Gene2008, 411, 38–45. [Google Scholar] [CrossRef] [PubMed]
Dai, L.; Taylor, M.S.; O’Donnell, K.A.; Boeke, J.D. Poly(A) binding protein C1 is essential for efficient L1 retrotransposition and affects L1 RNP formation. Mol. Cell Biol.2012, 32, 4323–4336. [Google Scholar] [CrossRef]
Suzuki, Y.; Craigie, R. The road to chromatin—Nuclear entry of retroviruses. Nat. Rev. Microbiol.2007, 5, 187–196. [Google Scholar] [CrossRef]
Shi, J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein expression between human livers and the hepatic cell lines HepG2, Hep3B, and Huh7 using SWATH and MRM-HR proteomics: Focusing on drug-metabolizing enzymes. Drug Metab. Pharmacokinet.2018, 33, 133–140. [Google Scholar] [CrossRef] [PubMed]
Kubo, S.; Seleme, M.C.; Soifer, H.S.; Perez, J.L.; Moran, J.V.; Kazazian, H.H., Jr.; Kasahara, N. L1 retrotransposition in nondividing and primary human somatic cells. Proc. Natl. Acad. Sci. USA2006, 103, 8036–8041. [Google Scholar] [CrossRef] [PubMed]
Macia, A.; Widmann, T.J.; Heras, S.R.; Ayllon, V.; Sanchez, L.; Benkaddour-Boumzaouad, M.; Munoz-Lopez, M.; Rubio, A.; Amador-Cubero, S.; Blanco-Jimenez, E.; et al. Engineered LINE-1 retrotransposition in nondividing human neurons. Genome Res.2017, 27, 335–348. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Meer over het farmaceutische maffia lid Pfizer: ‘Pfizer CEO: Israëliërs zijn proefkonijn voor testen van vaccin‘ (!!!!) De CEO van Pfizer die zonder blikken of blozen aangeeft waar het om gaat als men gevaccineerd is……. Israël waar intussen velen al spijt hebben zich te hebben laten vaccineren….. Intussen heeft Pfizer afgezien van een contract met India, daar het land extra garanties wilde over de veiligheid en daar zag Pfizer geen brood in…… India een land met een bevolking van 1,3 miljard mensen, ofwel daar was genoeg winst te behalen voor Pfizer; moet je nagaan….. Er is nog een groot land dat extra veiligheid eiste, waarop Pfizer ook de stekker uit die onderhandelingen trok….. Als je hier naar zoekt op het net, maakt niet uit op wat voor manier, vind je hier niets over terug, tekenend……..
‘Pfizer Coronavirus vaccin: wat je niet wordt verteld over de vaccins tegen COVID-19‘ In augustus 2020 deed Pfizer CEO Bourla 62% van z’n aandelen Pfizer van de hand, blijkbaar heeft hij er geen vertrouwen in dat de beloften van overheden dat het bedrijf niet vervolgd zal worden voor ernstige bijwerkingen ook zullen worden geëerbiedigd door rechters mocht men het bedrijf aanklagen voor doden als gevolg van vaccinatie dan wel voor ernstige (chronische) bijwerkingen……
‘Intrekken uitzendlicentie door Rusland voor Deutsche Welle ‘is een klap in het gezicht van het Duitse volk’‘ RT Deutsch dat werd platgelegd in Duitsland wordt o.a. verweten complottheorieën over COVID te brengen, dit door het uitzenden van een gesprek met een paar COVID-vaccinatieweigeraars……. (te zot voor woorden!!) Oh, en Deutsche Welle is een Duitse staatsomroep die westerse propaganda uitzond in Rusland, iets waarover men niet lult in het westen en als men er al over spreeekt wordt er onomwonden gezegd dat dit soort westerse platforms onafhankelijk zijn….. ha! ha! ha! ha! ha! ha! ha!
‘COVID-19 vaccin zou het immuunsysteem aantasten…….‘ (!!!!) Benieuwd ook of de vandaag (het is terwijl ik dit schrijf 11 januari 2022 /////) overleden David Sassoli, voorzitter van het EU parlement, 3 dubbel gevaccineerd was, daar ook hij een afwijking had aan het immuunsysteem……
‘Coronavirus: paniek over de Deltavariant is onterecht en zwaar overdreven‘ (!!!!) En zie de links in dat bericht naar artikelen over de PCR test en de bezuinigingen op de gezondheidszorg >> die bezuinigingen zijn de reden voor de Coronamaatregelen, die werden immers genomen daar er te weinig ziekenhuisbedden, IC bedden en verpleegkundigen waren. Zoals ook in het bericht hierboven al gemeld: het aantal verpleegkundigen is als de bedden sterk teruggelopen door wanbeleid van de afbraakkabinetten Rutte 1, 2 en 3….. Zo waren er bij aantreden van Rutte 1 nog 2.200 IC bedden, dat was bij aanvang van de Coronacrisis teruggebracht naar 1.100 bedden….. Dus als je sterk bent benadeeld door de Coronamaatregelen, weet je wie hiervoor verantwoordelijk zijn!! Zie wat betreft dat bericht ook: ‘Coronavirus: artsen willen via rechtszaak tegen de staat COVID-19 van A-lijst krijgen, daar het een griepvirus zou zijn‘De video die oorspronkelijk in het artikel was te zien is gecensureerd, tja je wilt natuurlijk niet dat de bevolking begrijpt hoezeer men werd en wordt belazerd……
‘Coronabeslommeringen: ook na vaccinatie kan je het virus doorgeven, plus de zoveelste blunder van CDA minister de Jonge‘ Het na dit bericht gebrachte nieuws dat je niet besmettelijk bent na vaccinatie, is achteraf gebeleken grote onzin te zijn en zou gebaseerd zijn op een foute interpretatie van een bericht uit de VS, lijkt me ook logisch daar dr Fauci eerder al meldde dat gevaccineerden nog lang besmettelijk blijven en zich aan de Coronamaatregelen dienen te houden, terwijl de voormaligfe minister van Volksgezodnheid, CDA plork fde Jonge vorig jaar zelf toegaf dat gevaccineerden niet veilig zijn…… (zie de afbeelding met deze zwaar disfunctionerende kwezel in het blok met Pfizer links hierboven)
Via het Linkedin account van Mario Ortiz Martinez vond ik de volgende productie waarin wordt uitgelegd dat het Pfizer vaccin het DNA van de lever aantast. Voorts wordt de Neurenberg Code aangehaald, waarin duidelijk is weergegeven dat het iedereen vrij moet staan om wel dan niet te kiezen voor een vaccinatie en gezien de tekst zit daar geen woord Spaans bij (overigens heeft de EU eerder laten weten tegen verpolichte vaccinatie te zijn, al is die mening intussen losgelaten door hare kwaadaardigheid von der Leyen, althans als ik me niet vergis):
“1. The voluntary consent of the human subject is absolutely essential.This means that the person involved should have legal capacity to give consent; should be so situated as to be able to exercise free power of choice, without the intervention of any element of force, fraud, deceit, duress, over-reaching, or other ulterior form of constraint or coercion.”
Deze tekst kom je hieronder nogmaals tegen en gezien de volledige tekst is het m.i. onverantwoord om je te laten vaccineren met het Pfizer vaccin. Maar lees de tekst en vorm je eigen oordeel. (zie alvorens tot vaccinatie over te gaan ook de berichten onder de door mij toegevoegde links en ook daarbij: vorm je eigen mening)
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
(als
je het Engels niet machtig bent, kopieer dan de Engelse tekst en plak
die in deze
vertaalapp,
de app werkt snel en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt kan je kiezen voor Nederlands)
Farma Medical-Marketing Projects, Medical & Farma 3D animation videos, Director Herr Zimmerman – Events & Music.
8 u •
Peter J. Merrick
• 3de+
Expert in Business Succession/Exiting Execution – Speaker – Author of The Business Novel – The King of Main Street
20 u • Bewerkt •
20 uur geleden
URGENT – BE IN FORMED – Please Read and Then Share
with Loved Ones: Study shows Pfizer COVID shot changes the liver cells
DNA according to Swedish researchers at Lund University – one of
Europe’s oldest and most prestigious research universities. These
findings are published in the current -March 2022- Issue of the
peer-reviewed journal – Molecular Biology.
***This first source full peer-reviewed article is included with this post below.***
ARTICLE
ABSTRACT: These researchers found that messenger RNA (mRNA)
from Pfizer’s COVID-19 gene therapy shot is able to enter
human liver cells and convert into DNA- combining with the human genome –
creating something – NEW – NEVER SEEN BEFORE!!!!!!
THIS IS CAUSE FOR ALARM – ARE HUMANS PATENABLE?
On
June 13, 2013 – the US Supreme Court ruled that DNA manipulated by
humans are eligible to be patented. This synthetic DNA is produced from
messenger RNA that serves as the instructions for making proteins in the
cell. Does this sound familiar? (i.e. – mRNA shots) – You can’t write
this stuff up.
Again, please read and then share this
document/article with as many people you care about as possible. Below
in the comments a link to a down loadable pdf has been provided.
FOOD FOR THOUGHT:
WHAT
IS INFORMED CONSENT – Point One of The Nuremberg Code – this is taken
directly from United States National Institutes of Health:
“1.
The voluntary consent of the human subject is absolutely essential. This
means that the person involved should have legal capacity to give
consent; should be so situated as to be able to exercise free power of
choice, without the intervention of any element of force, fraud, deceit,
duress, over-reaching, or other ulterior form of constraint or
coercion.”
Preclinical studies of COVID-19 mRNA vaccine BNT162b2, developed by
Pfizer and BioNTech, showed reversible hepatic effects in animals that
received the BNT162b2 injection. Furthermore, a recent study showed that
SARS-CoV-2 RNA can be reverse-transcribed and integrated into the
genome of human cells. In this study, we investigated the effect of
BNT162b2 on the human liver cell line Huh7 in vitro. Huh7 cells were
exposed to BNT162b2, and quantitative PCR was performed on RNA extracted
from the cells. We detected high levels of BNT162b2 in Huh7 cells and
changes in gene expression of long interspersed nuclear element-1
(LINE-1), which is an endogenous reverse transcriptase.
Immunohistochemistry using antibody binding to LINE-1 open reading
frame-1 RNA-binding protein (ORFp1) on Huh7 cells treated with BNT162b2
indicated increased nucleus distribution of LINE-1. PCR on genomic DNA
of Huh7 cells exposed to BNT162b2 amplified the DNA sequence unique to
BNT162b2. Our results indicate a fast up-take of BNT162b2 into human
liver cell line Huh7, leading to changes in LINE-1 expression and
distribution. We also show that BNT162b2 mRNA is reverse transcribed
intracellularly into DNA in as fast as 6 h upon BNT162b2 exposure.
Coronavirus
disease 2019 (COVID-19) caused by severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2) was announced by the World Health
Organization (WHO) as a global pandemic on 11 March 2020, and it emerged
as a devasting health crisis. As of February 2022, COVID-19 has led to
over 430 million reported infection cases and 5.9 million deaths
worldwide [1]. Effective and safe vaccines are urgently needed to reduce the morbidity and mortality rates associated with COVID-19.
Several
vaccines for COVID-19 have been developed, with particular focus on
mRNA vaccines (by Pfizer-BioNTech and Moderna), replication-defective
recombinant adenoviral vector vaccines (by Janssen-Johnson and Johnson,
Astra-Zeneca, Sputnik-V, and CanSino), and inactivated vaccines (by
Sinopharm, Bharat Biotech and Sinovac). The mRNA vaccine has the
advantages of being flexible and efficient in immunogen design and
manufacturing, and currently, numerous vaccine candidates are in various
stages of development and application. Specifically, COVID-19 mRNA
vaccine BNT162b2 developed by Pfizer and BioNTech has been evaluated in
successful clinical trials [2,3,4] and administered in national COVID-19 vaccination campaigns in different regions around the world [5,6,7,8].
BNT162b2
is a lipid nanoparticle (LNP)–encapsulated, nucleoside-modified RNA
vaccine (modRNA) and encodes the full-length of SARS-CoV-2 spike (S)
protein, modified by two proline mutations to ensure antigenically
optimal pre-fusion conformation, which mimics the intact virus to elicit
virus-neutralizing antibodies [3].
Consistent with randomized clinical trials, BNT162b2 showed high
efficiency in a wide range of COVID-19-related outcomes in a real-world
setting [5].
Nevertheless, many challenges remain, including monitoring for
long-term safety and efficacy of the vaccine. This warrants further
evaluation and investigations. The safety profile of BNT162b2 is
currently only available from short-term clinical studies. Less common
adverse effects of BNT162b2 have been reported, including pericarditis,
arrhythmia, deep-vein thrombosis, pulmonary embolism, myocardial
infarction, intracranial hemorrhage, and thrombocytopenia [4,9,10,11,12,13,14,15,16,17,18,19,20]. There are also studies that report adverse effects observed in other types of vaccines [21,22,23,24].
To better understand mechanisms underlying vaccine-related adverse
effects, clinical investigations as well as cellular and molecular
analyses are needed.
A recent study showed that SARS-CoV-2 RNAs can be reverse-transcribed and integrated into the genome of human cells [25].
This gives rise to the question of if this may also occur with
BNT162b2, which encodes partial SARS-CoV-2 RNA. In pharmacokinetics data
provided by Pfizer to European Medicines Agency (EMA), BNT162b2
biodistribution was studied in mice and rats by intra-muscular injection
with radiolabeled LNP and luciferase modRNA. Radioactivity was detected
in most tissues from the first time point (0.25 h), and results showed
that the injection site and the liver were the major sites of
distribution, with maximum concentrations observed at 8–48 h post-dose [26].
Furthermore, in animals that received the BNT162b2 injection,
reversible hepatic effects were observed, including enlarged liver,
vacuolation, increased gamma glutamyl transferase (γGT) levels, and
increased levels of aspartate transaminase (AST) and alkaline
phosphatase (ALP) [26]. Transient hepatic effects induced by LNP delivery systems have been reported previously [27,28,29,30],
nevertheless, it has also been shown that the empty LNP without modRNA
alone does not introduce any significant liver injury [27].
Therefore, in this study, we aim to examine the effect of BNT162b2 on a
human liver cell line in vitro and investigate if BNT162b2 can be
reverse transcribed into DNA through endogenous mechanisms.
2. Materials and Methods
2.1. Cell Culture
Huh7 cells (JCRB Cell Bank, Osaka, Japan) were cultured in 37 °C at 5% CO2 with DMEM medium (HyClone, HYCLSH30243.01) supplemented with 10% (v/v) fetal bovine serum (Sigma-Aldrich, F7524-500ML, Burlington, MA, USA) and 1% (v/v)
Penicillin-Streptomycin (HyClone, SV30010, Logan, UT, USA). For
BNT162b2 treatment, Huh7 cells were seeded with a density of 200,000
cells/well in 24-well plates. BNT162b2 mRNA vaccine (Pfizer BioNTech,
New York, NY, USA) was diluted with sterile 0.9% sodium chloride
injection, USP into a final concentration of 100 μg/mL as described in
the manufacturer’s guideline [31].
BNT162b2 suspension was then added in cell culture media to reach final
concentrations of 0.5, 1.0, or 2.0 μg/mL. Huh7 cells were incubated
with or without BNT162b2 for 6, 24, and 48 h. Cells were washed
thoroughly with PBS and harvested by trypsinization and stored in −80 °C
until further use.
2.2. REAL-TIME RT-QPCR
RNA
from the cells was extracted with RNeasy Plus Mini Kit (Qiagen, 74134,
Hilden, Germany) following the manufacturer’s protocol. RT-PCR was
performed using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher
Scientific, K1622, Waltham, MA, USA) following the manufacturers
protocol. Real-time qPCR was performed using Maxima SYBR Green/ROX qPCR
Master Mix (Thermo Fisher Scientific, K0222, Waltham, MA, USA) with
primers for BNT162b2, LINE-1 and housekeeping genes ACTB and GAPDH (Table 1).
Table 1.
Primer sequences of RT-qPCR and PCR.
Table 1.
Primer sequences of RT-qPCR and PCR.
Target
Sequence
ACTB forward
CCTCGCCTTTGCCGATCC
ACTB reverse
GGATCTTCATGAGGTAGTCAGTC
GAPDH forward
CTCTGCTCCTCCTGTTCGAC
GAPDH reverse
TTAAAAGCAGCCCTGGTGAC
LINE-1 forward
TAACCAATACAGAGAAGTGC
LINE-1 reverse
GATAATATCCTGCAGAGTGT
BNT162b2 forward
CGAGGTGGCCAAGAATCTGA
BNT162b2 reverse
TAGGCTAAGCGTTTTGAGCTG
2.3. Immunofluorescence Staining and Confocal Imaging
Huh7
cells were cultured in eight-chamber slides (LAB-TEK, 154534, Santa
Cruz, CA, USA) with a density of 40,000 cells/well, with or without
BNT162b2 (0.5, 1 or 2 µg/mL) for 6 h. Immunohistochemistry was performed
using primary antibody anti-LINE-1 ORF1p mouse monoclonal antibody
(Merck, 3574308, Kenilworth, NJ, USA), secondary antibody Cy3 Donkey
anti-mouse (Jackson ImmunoResearch, West Grove, PA, USA), and Hoechst
(Life technologies, 34850, Carlsbad, CA, USA), following the protocol
from Thermo Fisher (Waltham, MA, USA). Two images per condition were
taken using a Zeiss LSM 800 and a 63X oil immersion objective, and the
staining intensity was quantified on the individual whole cell area and
the nucleus area on 15 cells per image by ImageJ 1.53c. LINE-1 staining
intensity for the cytosol was calculated by subtracting the intensity of
the nucleus from that of the whole cell. All images of the cells were
assigned a random number to prevent bias. To mark the nuclei (determined
by the Hoechst staining) and the whole cells (determined by the borders
of the LINE-1 fluorescence), the Freehand selection tool was used.
These areas were then measured, and the mean intensity was used to
compare the groups.
2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and Sanger Sequencing
Genomic
DNA was extracted from cell pellets with PBND buffer (10 mM Tris-HCl pH
8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20) according to
protocol described previously [32].
To remove residual RNA from the DNA preparation, RNase (100 µg/mL,
Qiagen, Hilden, Germany) was added to the DNA preparation and incubated
at 37 °C for 3 h, followed by 5 min at 95 °C. PCR was then performed
using primers targeting BNT162b2 (sequences are shown in Table 1),
with the following program: 5 min at 95 °C, 35 cycles of 95 °C for 30
s, 58 °C for 30 s, and 72 °C for 1 min; finally, 72 °C for 5 min and 12
°C for 5 min. PCR products were run on 1.4% (w/v)
agarose gel. Bands corresponding to the amplicons of the expected size
(444 bps) were cut out and DNA was extracted using QIAquick PCR
Purification Kit (Qiagen, 28104, Hilden, Germany), following the
manufacturer’s instructions. The sequence of the DNA amplicon was
verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany).
Statistics
Statistical comparisons were performed using two-tailed Student’s t-test and ANOVA. Data are expressed as the mean ± SEM or ± SD. Differences with p < 0.05 are considered significant.
2.5. Ethical Statements
The Huh7 cell line was obtained from Japanese Collection of Research Bioresources (JCRB) Cell Bank.
3. Results
3.1. BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency
To
determine if BNT162b2 enters human liver cells, we exposed human liver
cell line Huh7 to BNT162b2. In a previous study on the uptake kinetics
of LNP delivery in Huh7 cells, the maximum biological efficacy of LNP
was observed between 4–7 h [33].
Therefore, in our study, Huh7 cells were cultured with or without
increasing concentrations of BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6,
24, and 48 h. RNA was extracted from cells and a real-time quantitative
reverse transcription polymerase chain reaction (RT-qPCR) was performed
using primers targeting the BNT162b2 sequence, as illustrated in Figure 1. The full sequence of BNT162b2 is publicly available [34]
and contains a two-nucleotides cap; 5′- untranslated region (UTR) that
incorporates the 5′ -UTR of a human α-globin gene; the full-length of
SARS-CoV-2 S protein with two proline mutations; 3′-UTR that
incorporates the human mitochondrial 12S rRNA (mtRNR1) segment and human
AES/TLE5 gene segment with two C→U mutations; poly(A) tail. Detailed
analysis of the S protein sequence in BNT162b2 revealed 124 sequences
that are 100% identical to human genomic sequences and three sequences
with only one nucleotide (nt) mismatch in 19–26 nts (Table S1, see Supplementary Materials).
To detect BNT162b2 RNA level, we designed primers with forward primer
located in SARS-CoV-2 S protein regions and reverse primer in 3′-UTR,
which allows detection of PCR amplicon unique to BNT162b2 without
unspecific binding of the primers to human genomic regions.
Figure 1.
PCR primer set used to detect mRNA level and reverse-transcription of
BNT162b2. Illustration of BNT162b2 was adapted from previously described
literature [34].
RT-qPCR results showed that Huh7 cells treated
with BNT162b2 had high levels of BNT162b2 mRNA relative to housekeeping
genes at 6, 24, and 48 h (Figure 2, presented in logged 2−ΔΔCT
due to exceptionally high levels). The three BNT162b2 concentrations
led to similar intracellular BNT162b2 mRNA levels at the different time
points, except that the significant difference between 1.0 and 2.0 µg/mL
was observed at 48 h. BNT162b2 mRNA levels were significantly decreased
at 24 h compared to 6 h, but increased again at 48 h.
Figure 2.
BNT162b2 mRNA levels in Huh7 cells treated with BNT162b2. Huh7 cells
were treated without (Ctrl) or with 0.5 (V1), 1 (V2), and 2 µg/mL (V3)
of BNT162b2 for 6 (green dots), 24 (orange dots), and 48 h (blue dots).
RNA was purified and qPCR was performed using primers targeting
BNT162b2. RNA levels of BNT162b2 are presented as logged 2−ΔΔCT values relative to house-keeping genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated).
3.2. Effect of BNT162b2 on Human Endogenous Reverse Transcriptase Long Interspersed Nuclear Element-1 (LINE-1)
Here we examined the effect of BNT162b2 on LINE-1
gene expression. RT-qPCR was performed on RNA purified from Huh7 cells
treated with BNT162b2 (0, 0.5, 1.0, and 2.0 µg/mL) for 6, 24, and 48 h,
using primers targeting LINE-1. Significantly increased LINE-1 expression compared to control was observed at 6 h by 2.0 µg/mL BNT162b2, while lower BNT162b2 concentrations decreased LINE-1 expression at all time points (Figure 3).
Figure 3. LINE-1 mRNA levels in Huh7 cells
treated with BNT162b2. Huh7 cells were treated without (Ctrl) or with
0.5 (V1), 1 (V2), and 2 µg/mL (V3) of BNT162b2 for 6 (green dots), 24
(red dots), and 48 h (blue dots). RNA was purified and qPCR was
performed using primers targeting LINE-1. RNA levels of LINE-1 are presented as 2−ΔΔCT values relative to house-keeping genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated; † p < 0.05 vs. 6 h-Ctrl).
Next, we studied the effect of BNT162b2 on
LINE-1 protein level. The full-length LINE-1 consists of a 5′
untranslated region (UTR), two open reading frames (ORFs), ORF1 and
ORF2, and a 3′UTR, of which ORF1 is an RNA binding protein with
chaperone activity. The retrotransposition activity of LINE-1 has been
demonstrated to involve ORF1 translocation to the nucleus [35].
Huh7 cells treated with or without BNT162b2 (0.5, 1.0 and 2.0 µg/mL)
for 6 h were fixed and stained with antibodies binding to LINE-1 ORF1p,
and DNA-specific probe Hoechst for visualization of cell nucleus (Figure 4a).
Quantification of immunofluorescence staining intensity showed that
BNT162b2 increased LINE-1 ORF1p protein levels in both the whole cell
area and nucleus at all concentrations tested (Figure 4b–d).
Figure 4.
Immunohistochemistry of Huh7 cells treated with BNT162b2 on LINE-1
protein distribution. Huh7 cells were treated without (Ctrl) or with
0.5, 1, and 2 µg/mL of BNT162b2 for 6 h. Cells were fixed and stained
with antibodies binding to LINE-1 ORF1p (red) and DNA-specific probe
Hoechst for visualization of cell nucleus (blue). (a) Representative images of LINE-1 expression in Huh7 cells treated with or without BNT162b2. (b–d) Quantification of LINE-1 protein in whole cell area (b), cytosol (c), and nucleus (d).
All data were analyzed using One-Way ANOVA, and graphs were created
using GraphPad Prism V 9.2. All data is presented as mean ± SD (** p < 0.01; *** p < 0.001; **** p < 0.0001 as indicated).
3.3. Detection of Reverse Transcribed BNT162b2 DNA in Huh7 Cells
A previous study has shown that entry of LINE-1 protein into the nucleus is associated with retrotransposition [35].
In the immunofluorescence staining experiment described above,
increased levels of LINE-1 in the nucleus were observed already at the
lowest concentration of BNT162b2 (0.5 µg/mL). To examine if BNT162b2 is
reversely transcribed into DNA when LINE-1 is elevated, we purified
genomic DNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2 for 6,
24, and 48 h. Purified DNA was treated with RNase to remove RNA and
subjected to PCR using primers targeting BNT162b2, as illustrated in Figure 1. Amplified DNA fragments were then visualized by electrophoresis and gel-purified (Figure 5).
BNT162b2 DNA amplicons were detected in all three time points (6, 24,
and 48 h). Sanger sequencing confirmed that the DNA amplicons were
identical to the BNT162b2 sequence flanked by the primers (Table 2).
To ensure that the DNA amplicons were derived from DNA but not BNT162b2
RNA, we also performed PCR on RNA purified from Huh7 cells treated with
0.5 µg/mL BNT162b2 for 6 h, with or without RNase treatment (Ctrl 5 and
6 in Figure 5), and no amplicon was detected in the RNA samples subjected to PCR.
Figure 5.
Detection of DNA amplicons of BNT162b2 in Huh7 cells treated with
BNT162b2. Huh7 cells were treated without (Ctrl) or with 0.5 µg/mL of
BNT162b2 for 6, 24, and 48 h. Genomic DNA was purified and digested with
100 µg/mL RNase. PCR was run on all samples with primers targeting
BNT162b2, as shown in Figure 1 and Table 1.
DNA amplicons (444 bps) were visualized on agarose gel. BNT: BNT162b2;
L: DNA ladder; Ctrl1: cultured Huh7 cells; Ctrl2: Huh7 cells without
BNT162b2 treatment collected at 6 h; Ctrl3: Huh7 cells without BNT162b2
treatment collected at 24 h; Ctrl4: Huh7 cells without BNT162b2
treatment collected at 48 h; Ctrl5: RNA from Huh7 cells treated with 0.5
µg/mL of BNT162b2 for 6 h; Ctrl6: RNA from Huh7 cells treated with 0.5
µg/mL of BNT162b2 for 6 h, digested with RNase.
Table 2.
Sanger sequencing result of the BNT162b2 amplicon.
Table 2.
Sanger sequencing result of the BNT162b2 amplicon.
In
this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is
able to enter the human liver cell line Huh7 in vitro. BNT162b2 mRNA is
reverse transcribed intracellularly into DNA as fast as 6 h after
BNT162b2 exposure. A possible mechanism for reverse transcription is
through endogenous reverse transcriptase LINE-1, and the nucleus protein
distribution of LINE-1 is elevated by BNT162b2.
Intracellular accumulation of LNP in hepatocytes has been demonstrated in vivo [36].
A preclinical study on BNT162b2 showed that BNT162b2 enters the human
cell line HEK293T cells and leads to robust expression of BNT162b2
antigen [37].
Therefore, in this study, we first investigated the entry of BNT162b2
in the human liver cell line Huh7 cells. The choice of BNT162b2
concentrations used in this study warrants explanation. BNT162b2 is
administered as a series of two doses three weeks apart, and each dose
contains 30 µg of BNT162b2 in a volume of 0.3 mL, which makes the local
concentration at the injection site at the highest 100 µg/mL [31].
A previous study on mRNA vaccines against H10N8 and H7N9 influenza
viruses using a similar LNP delivery system showed that the mRNA vaccine
can distribute rather nonspecifically to several organs such as liver,
spleen, heart, kidney, lung, and brain, and the concentration in the
liver is roughly 100 times lower than that of the intra-muscular
injection site [38].
In the assessment report on BNT162b2 provided to EMA by Pfizer, the
pharmacokinetic distribution studies in rats demonstrated that a
relatively large proportion (up to 18%) of the total dose distributes to
the liver [26].
We therefore chose to use 0.5, 1, and 2 μg/mL of vaccine in our
experiments on the liver cells. However, the effect of a broader range
of lower and higher concentrations of BNT162b2 should also be verified
in future studies.
In the current study, we
employed a human liver cell line for in vitro investigation. It is worth
investigating if the liver cells also present the vaccine-derived
SARS-CoV-2 spike protein, which could potentially make the liver cells
targets for previously primed spike protein reactive cytotoxic T cells.
There has been case reports on individuals who developed autoimmune
hepatitis [39]
after BNT162b2 vaccination. To obtain better understanding of the
potential effects of BNT162b2 on liver function, in vivo models are
desired for future studies.
In the BNT162b2 toxicity report, no genotoxicity nor carcinogenicity studies have been provided [26].
Our study shows that BNT162b2 can be reverse transcribed to DNA in
liver cell line Huh7, and this may give rise to the concern if
BNT162b2-derived DNA may be integrated into the host genome and affect
the integrity of genomic DNA, which may potentially mediate genotoxic
side effects. At this stage, we do not know if DNA reverse transcribed
from BNT162b2 is integrated into the cell genome. Further studies are
needed to demonstrate the effect of BNT162b2 on genomic integrity,
including whole genome sequencing of cells exposed to BNT162b2, as well
as tissues from human subjects who received BNT162b2 vaccination.
Human
autonomous retrotransposon LINE-1 is a cellular endogenous reverse
transcriptase and the only remaining active transposon in humans, able
to retrotranspose itself and other nonautonomous elements [40,41], and ~17% of the human genome are comprised of LINE-1 sequences [42]. The nonautonomous Alu
elements, short, interspersed nucleotide elements (SINEs),
variable-number-of-tandem-repeats (VNTR), as well as cellular
mRNA-processed pseudogenes, are retrotransposed by the LINE-1
retrotransposition proteins working in trans [43,44].
A recent study showed that endogenous LINE-1 mediates reverse
transcription and integration of SARS-CoV-2 sequences in the genomes of
infected human cells [25]. Furthermore, expression of endogenous LINE-1 is often increased upon viral infection, including SARS-CoV-2 infection [45,46,47]. Previous studies showed that LINE-1 retrotransposition activity is regulated by RNA metabolism [48,49], DNA damage response [50], and autophagy [51]. Efficient retrotransposition of LINE-1 is often associated with cell cycle and nuclear envelope breakdown during mitosis [52,53], as well as exogenous retroviruses [54,55],
which promotes entrance of LINE-1 into the nucleus. In our study, we
observed increased LINE-1 ORF1p distribution as determined by
immunohistochemistry in the nucleus by BNT162b2 at all concentrations
tested (0.5, 1, and 2 μg/mL), while elevated LINE-1
gene expression was detected at the highest BNT162b2 concentration (2
μg/mL). It is worth noting that gene transcription is regulated by
chromatin modifications, transcription factor regulation, and the rate
of RNA degradation, while translational regulation of protein involves
ribosome recruitment on the initiation codon, modulation of peptide
elongation, termination of protein synthesis, or ribosome biogenesis.
These two processes are controlled by different mechanisms, and
therefore they may not always show the same change patterns in response
to external challenges. The exact regulation of LINE-1 activity in
response to BNT162b2 merits further study.
The
cell model that we used in this study is a carcinoma cell line, with
active DNA replication which differs from non-dividing somatic cells. It
has also been shown that Huh7 cells display significant different gene
and protein expression including upregulated proteins involved in RNA
metabolism [56].
However, cell proliferation is also active in several human tissues
such as the bone marrow or basal layers of epithelia as well as during
embryogenesis, and it is therefore necessary to examine the effect of
BNT162b2 on genomic integrity under such conditions. Furthermore,
effective retrotransposition of LINE-1 has also been reported in
non-dividing and terminally differentiated cells, such as human neurons [57,58].
The
Pfizer EMA assessment report also showed that BNT162b2 distributes in
the spleen (<1.1%), adrenal glands (<0.1%), as well as low and
measurable radioactivity in the ovaries and testes (<0.1%) [26].
Furthermore, no data on placental transfer of BNT162b2 is available
from Pfizer EMA assessment report. Our results showed that BNT162b2 mRNA
readily enters Huh7 cells at a concentration (0.5 µg/mL) corresponding
to 0.5% of the local injection site concentration, induce changes in
LINE-1 gene and protein expression, and within 6 h, reverse
transcription of BNT162b2 can be detected. It is therefore important to
investigate further the effect of BNT162b2 on other cell types and
tissues both in vitro and in vivo.
5. Conclusions
Our
study is the first in vitro study on the effect of COVID-19 mRNA
vaccine BNT162b2 on human liver cell line. We present evidence on fast
entry of BNT162b2 into the cells and subsequent intracellular reverse
transcription of BNT162b2 mRNA into DNA.
M.A.,
F.O.F., D.Y., M.B. and C.L. performed in vitro experiments. M.A. and
F.O.F. performed data analysis. M.R. and Y.D.M. contributed to the
implementation of the research, designed, and supervised the study.
Y.D.M. wrote the paper with input from all authors. All authors have
read and agreed to the published version of the manuscript.
Funding
This
study was supported by the Swedish Research Council (SRC), Strategic Research
Area Exodiab, Dnr 2009-1039, the Swedish Government Fund for Clinical
Research (ALF) and the foundation of Skåne University Hospital.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All data supporting the findings of this study are available within the article and supporting information.
Acknowledgments
The
authors thank Sven Haidl, Maria Josephson, Enming Zhang, Jia-Yi Li,
Caroline Haikal, and Pradeep Bompada for their support to this study.
Conflicts of Interest
The authors declare no conflict of interest.
References
World Health Organization. Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on 22 February 2022).
Mulligan,
M.J.; Lyke, K.E.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.;
Neuzil, K.; Raabe, V.; Bailey, R.; Swanson, K.A.; et al. Phase I/II
study of COVID-19 RNA vaccine BNT162b1 in adults. Nature2020, 586, 589–593. [Google Scholar] [CrossRef] [PubMed]
Walsh,
E.E.; Frenck, R.W., Jr.; Falsey, A.R.; Kitchin, N.; Absalon, J.;
Gurtman, A.; Lockhart, S.; Neuzil, K.; Mulligan, M.J.; Bailey, R.; et
al. Safety and Immunogenicity of Two RNA-Based COVID-19 Vaccine
Candidates. N. Engl. J. Med.2020, 383, 2439–2450. [Google Scholar] [CrossRef] [PubMed]
Polack,
F.P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart,
S.; Perez, J.L.; Perez Marc, G.; Moreira, E.D.; Zerbini, C.; et al.
Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine. N. Engl. J. Med.2020, 383, 2603–2615. [Google Scholar] [CrossRef] [PubMed]
Harris,
R.J.; Hall, J.A.; Zaidi, A.; Andrews, N.J.; Dunbar, J.K.; Dabrera, G.
Effect of Vaccination on Household Transmission of SARS-CoV-2 in
England. N. Engl. J. Med.2021, 385, 759–760. [Google Scholar] [CrossRef]
Butt,
A.A.; Omer, S.B.; Yan, P.; Shaikh, O.S.; Mayr, F.B. SARS-CoV-2 Vaccine
Effectiveness in a High-Risk National Population in a Real-World
Setting. Ann. Intern. Med.2021, 174, 1404–1408. [Google Scholar] [CrossRef]
Dagan,
N.; Barda, N.; Kepten, E.; Miron, O.; Perchik, S.; Katz, M.A.; Hernan,
M.A.; Lipsitch, M.; Reis, B.; Balicer, R.D. BNT162b2 mRNA Covid-19
Vaccine in a Nationwide Mass Vaccination Setting. N. Engl. J. Med.2021, 384, 1412–1423. [Google Scholar] [CrossRef]
Rossman,
H.; Shilo, S.; Meir, T.; Gorfine, M.; Shalit, U.; Segal, E. COVID-19
dynamics after a national immunization program in Israel. Nat. Med.2021, 27, 1055–1061. [Google Scholar] [CrossRef]
Fan,
B.E.; Shen, J.Y.; Lim, X.R.; Tu, T.M.; Chang, C.C.R.; Khin, H.S.W.;
Koh, J.S.; Rao, J.P.; Lau, S.L.; Tan, G.B.; et al. Cerebral venous
thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: A black swan
event. Am. J. Hematol.2021, 96, E357–E361. [Google Scholar] [CrossRef]
Menni,
C.; Klaser, K.; May, A.; Polidori, L.; Capdevila, J.; Louca, P.; Sudre,
C.H.; Nguyen, L.H.; Drew, D.A.; Merino, J.; et al. Vaccine side-effects
and SARS-CoV-2 infection after vaccination in users of the COVID
Symptom Study app in the UK: A prospective observational study. Lancet Infect. Dis.2021, 21, 939–949. [Google Scholar] [CrossRef]
Hansen,
T.; Titze, U.; Kulamadayil-Heidenreich, N.S.A.; Glombitza, S.; Tebbe,
J.J.; Rocken, C.; Schulz, B.; Weise, M.; Wilkens, L. First case of
postmortem study in a patient vaccinated against SARS-CoV-2. Int. J. Infect. Dis.2021, 107, 172–175. [Google Scholar] [CrossRef] [PubMed]
Kadali,
R.A.K.; Janagama, R.; Peruru, S.; Malayala, S.V. Side effects of
BNT162b2 mRNA COVID-19 vaccine: A randomized, cross-sectional study with
detailed self-reported symptoms from healthcare workers. Int. J. Infect. Dis.2021, 106, 376–381. [Google Scholar] [CrossRef] [PubMed]
Parkash, O.; Sharko, A.; Farooqi, A.; Ying, G.W.; Sura, P. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine. Cureus2021, 13, e14741. [Google Scholar] [CrossRef] [PubMed]
Mazzatenta,
C.; Piccolo, V.; Pace, G.; Romano, I.; Argenziano, G.; Bassi, A.
Purpuric lesions on the eyelids developed after BNT162b2 mRNA COVID-19
vaccine: Another piece of SARS-CoV-2 skin puzzle? J. Eur. Acad. Dermatol. Venereol.2021, 35, e543–e545. [Google Scholar] [CrossRef]
Lee,
E.J.; Cines, D.B.; Gernsheimer, T.; Kessler, C.; Michel, M.; Tarantino,
M.D.; Semple, J.W.; Arnold, D.M.; Godeau, B.; Lambert, M.P.; et al.
Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol.2021, 96, 534–537. [Google Scholar] [CrossRef]
Das,
B.B.; Kohli, U.; Ramachandran, P.; Nguyen, H.H.; Greil, G.; Hussain,
T.; Tandon, A.; Kane, C.; Avula, S.; Duru, C.; et al. Myopericarditis
following mRNA COVID-19 Vaccination in Adolescents 12 through 18 Years
of Age. J. Pediatr.2021, 238, 26–32.e1. [Google Scholar] [CrossRef]
McLaurin-Jiang,
S.; Garner, C.D.; Krutsch, K.; Hale, T.W. Maternal and Child Symptoms
Following COVID-19 Vaccination Among Breastfeeding Mothers. Breastfeed. Med.2021, 16, 702–709. [Google Scholar] [CrossRef]
Barda,
N.; Dagan, N.; Ben-Shlomo, Y.; Kepten, E.; Waxman, J.; Ohana, R.;
Hernan, M.A.; Lipsitch, M.; Kohane, I.; Netzer, D.; et al. Safety of the
BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Setting. N. Engl. J. Med.2021, 385, 1078–1090. [Google Scholar] [CrossRef]
Baden,
L.R.; El Sahly, H.M.; Essink, B.; Kotloff, K.; Frey, S.; Novak, R.;
Diemert, D.; Spector, S.A.; Rouphael, N.; Creech, C.B.; et al. Efficacy
and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med.2021, 384, 403–416. [Google Scholar] [CrossRef]
Sadoff,
J.; Gray, G.; Vandebosch, A.; Cardenas, V.; Shukarev, G.; Grinsztejn,
B.; Goepfert, P.A.; Truyers, C.; Fennema, H.; Spiessens, B.; et al.
Safety and Efficacy of Single-Dose Ad26.COV2.S Vaccine against Covid-19. N. Engl. J. Med.2021, 384, 2187–2201. [Google Scholar] [CrossRef] [PubMed]
Eichinger, S.; Warkentin, T.E.; Greinacher, A. Thrombotic Thrombocytopenia after ChAdOx1 nCoV-19 Vaccination. Reply. N. Engl. J. Med.2021, 385, e11. [Google Scholar] [CrossRef] [PubMed]
Doroftei,
B.; Ciobica, A.; Ilie, O.D.; Maftei, R.; Ilea, C. Mini-Review
Discussing the Reliability and Efficiency of COVID-19 Vaccines. Diagnostics2021, 11, 579. [Google Scholar] [CrossRef]
Zhang,
L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch,
R. Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of
cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA2021, 118, e2105968118. [Google Scholar] [CrossRef] [PubMed]
Tanaka,
H.; Takata, N.; Sakurai, Y.; Yoshida, T.; Inoue, T.; Tamagawa, S.;
Nakai, Y.; Tange, K.; Yoshioka, H.; Maeki, M.; et al. Delivery of
Oligonucleotides Using a Self-Degradable Lipid-Like Material. Pharmaceutics2021, 13, 544. [Google Scholar] [CrossRef]
Sedic,
M.; Senn, J.J.; Lynn, A.; Laska, M.; Smith, M.; Platz, S.J.; Bolen, J.;
Hoge, S.; Bulychev, A.; Jacquinet, E.; et al. Safety Evaluation of
Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat
and Cynomolgus Monkey. Vet. Pathol.2018, 55, 341–354. [Google Scholar] [CrossRef]
Sato,
Y.; Matsui, H.; Yamamoto, N.; Sato, R.; Munakata, T.; Kohara, M.;
Harashima, H. Highly specific delivery of siRNA to hepatocytes
circumvents endothelial cell-mediated lipid nanoparticle-associated
toxicity leading to the safe and efficacious decrease in the hepatitis B
virus. J. Control. Release2017, 266, 216–225. [Google Scholar] [CrossRef]
Gallud,
A.; Munson, M.J.; Liu, K.; Idstrom, A.; Barriga, H.M.; Tabaei, S.;
Aliakbarinodehi, N.; Ojansivu, M.; Lubart, Q.; Doutch, J.J.; et al. Time
evolution of PEG-shedding and serum protein coronation determines the
cell uptake kinetics and delivery of lipid nanoparticle. bioRxiv2021. [Google Scholar] [CrossRef]
Mita,
P.; Wudzinska, A.; Sun, X.; Andrade, J.; Nayak, S.; Kahler, D.J.;
Badri, S.; LaCava, J.; Ueberheide, B.; Yun, C.Y.; et al. LINE-1 protein
localization and functional dynamics during the cell cycle. Elife2018, 7, e30058. [Google Scholar] [CrossRef]
Sato,
Y.; Kinami, Y.; Hashiba, K.; Harashima, H. Different kinetics for the
hepatic uptake of lipid nanoparticles between the apolipoprotein E/low
density lipoprotein receptor and the
N-acetyl-d-galactosamine/asialoglycoprotein receptor pathway. J. Control. Release2020, 322, 217–226. [Google Scholar] [CrossRef]
Vogel,
A.B.; Kanevsky, I.; Che, Y.; Swanson, K.A.; Muik, A.; Vormehr, M.;
Kranz, L.M.; Walzer, K.C.; Hein, S.; Guler, A.; et al. BNT162b vaccines
protect rhesus macaques from SARS-CoV-2. Nature2021, 592, 283–289. [Google Scholar] [CrossRef] [PubMed]
Bahl,
K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.;
Laska, M.E.; Smith, M.; Almarsson, O.; Thompson, J.; et al. Preclinical
and Clinical Demonstration of Immunogenicity by mRNA Vaccines against
H10N8 and H7N9 Influenza Viruses. Mol. Ther.2017, 25, 1316–1327. [Google Scholar] [CrossRef] [PubMed]
Bril,
F.; Al Diffalha, S.; Dean, M.; Fettig, D.M. Autoimmune hepatitis
developing after coronavirus disease 2019 (COVID-19) vaccine: Causality
or casualty? J. Hepatol.2021, 75, 222–224. [Google Scholar] [CrossRef]
Kazazian, H.H., Jr.; Moran, J.V. Mobile DNA in Health and Disease. N. Engl. J. Med.2017, 377, 361–370. [Google Scholar] [CrossRef] [PubMed]
Coffin, J.M.; Fan, H. The Discovery of Reverse Transcriptase. Annu. Rev. Virol.2016, 3, 29–51. [Google Scholar] [CrossRef]
Lander,
E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.;
Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al. Initial sequencing
and analysis of the human genome. Nature2001, 409, 860–921. [Google Scholar] [CrossRef]
Ostertag,
E.M.; Goodier, J.L.; Zhang, Y.; Kazazian, H.H., Jr. SVA elements are
nonautonomous retrotransposons that cause disease in humans. Am. J. Hum. Genet.2003, 73, 1444–1451. [Google Scholar] [CrossRef]
Hancks, D.C.; Kazazian, H.H., Jr. Active human retrotransposons: Variation and disease. Curr. Opin. Genet. Dev.2012, 22, 191–203. [Google Scholar] [CrossRef]
Jones,
R.B.; Song, H.; Xu, Y.; Garrison, K.E.; Buzdin, A.A.; Anwar, N.;
Hunter, D.V.; Mujib, S.; Mihajlovic, V.; Martin, E.; et al. LINE-1
retrotransposable element DNA accumulates in HIV-1-infected cells. J. Virol.2013, 87, 13307–13320. [Google Scholar] [CrossRef]
Macchietto,
M.G.; Langlois, R.A.; Shen, S.S. Virus-induced transposable element
expression up-regulation in human and mouse host cells. Life Sci. Alliance2020, 3, e201900536. [Google Scholar] [CrossRef] [PubMed]
Yin, Y.; Liu, X.Z.; He, X.; Zhou, L.Q. Exogenous Coronavirus Interacts With Endogenous Retrotransposon in Human Cells. Front. Cell Infect. Microbiol.2021, 11, 609160. [Google Scholar] [CrossRef] [PubMed]
Belancio, V.P.; Roy-Engel, A.M.; Deininger, P. The impact of multiple splice sites in human L1 elements. Gene2008, 411, 38–45. [Google Scholar] [CrossRef] [PubMed]
Dai,
L.; Taylor, M.S.; O’Donnell, K.A.; Boeke, J.D. Poly(A) binding protein
C1 is essential for efficient L1 retrotransposition and affects L1 RNP
formation. Mol. Cell Biol.2012, 32, 4323–4336. [Google Scholar] [CrossRef]
Suzuki, Y.; Craigie, R. The road to chromatin—Nuclear entry of retroviruses. Nat. Rev. Microbiol.2007, 5, 187–196. [Google Scholar] [CrossRef]
Shi,
J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein
expression between human livers and the hepatic cell lines HepG2, Hep3B,
and Huh7 using SWATH and MRM-HR proteomics: Focusing on
drug-metabolizing enzymes. Drug Metab. Pharmacokinet.2018, 33, 133–140. [Google Scholar] [CrossRef] [PubMed]
Kubo,
S.; Seleme, M.C.; Soifer, H.S.; Perez, J.L.; Moran, J.V.; Kazazian,
H.H., Jr.; Kasahara, N. L1 retrotransposition in nondividing and primary
human somatic cells. Proc. Natl. Acad. Sci. USA2006, 103, 8036–8041. [Google Scholar] [CrossRef] [PubMed]
Macia,
A.; Widmann, T.J.; Heras, S.R.; Ayllon, V.; Sanchez, L.;
Benkaddour-Boumzaouad, M.; Munoz-Lopez, M.; Rubio, A.; Amador-Cubero,
S.; Blanco-Jimenez, E.; et al. Engineered LINE-1 retrotransposition in
nondividing human neurons. Genome Res.2017, 27, 335–348. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Meer over het farmaceutische maffia lid Pfizer: ‘Pfizer CEO: Israëliërs zijn proefkonijn voor testen van vaccin‘ (!!!!) De CEO van Pfizer die zonder blikken of blozen aangeeft waar het om gaat als men gevaccineerd is……. Israël
waar intussen velen al spijt hebben zich te hebben laten
vaccineren….. Intussen heeft Pfizer afgezien van een contract met
India, daar het land extra garanties wilde over de veiligheid en daar
zag Pfizer geen brood in…… India een land met een bevolking van 1,3
miljard mensen, ofwel daar was genoeg winst te behalen voor Pfizer; moet
je nagaan….. Er is nog een groot land dat extra veiligheid eiste,
waarop Pfizer ook de stekker uit die onderhandelingen trok….. Als je
hier naar zoekt op het net, maakt niet uit op wat voor manier, vind je
hier niets over terug, tekenend……..
‘Pfizer Coronavirus vaccin: wat je niet wordt verteld over de vaccins tegen COVID-19‘
In augustus 2020 deed Pfizer CEO Bourla 62% van z’n aandelen Pfizer van
de hand, blijkbaar heeft hij er geen vertrouwen in dat de beloften van
overheden dat het bedrijf niet vervolgd zal worden voor ernstige
bijwerkingen ook zullen worden geëerbiedigd door rechters mocht men het
bedrijf aanklagen voor doden als gevolg van vaccinatie dan wel voor ernstige (chronische)
bijwerkingen……
‘Intrekken uitzendlicentie door Rusland voor Deutsche Welle ‘is een klap in het gezicht van het Duitse volk’‘
RT Deutsch dat werd platgelegd in Duitsland wordt o.a. verweten
complottheorieën over COVID te brengen, dit door het uitzenden van een
gesprek met een paar COVID-vaccinatieweigeraars……. (te zot voor
woorden!!) Oh, en Deutsche Welle is een Duitse staatsomroep die westerse
propaganda uitzond in Rusland, iets
waarover men niet lult in het westen en als men er al over spreeekt
wordt er onomwonden gezegd dat dit soort westerse platforms
onafhankelijk zijn….. ha! ha! ha! ha! ha! ha! ha!
‘COVID-19 vaccin zou het immuunsysteem aantasten…….‘ (!!!!)
Benieuwd ook of de vandaag (het is terwijl ik dit schrijf 11 januari 2022 /////) overleden
David Sassoli, voorzitter van het EU parlement, 3 dubbel gevaccineerd
was, daar ook hij een afwijking had aan het immuunsysteem……
‘Coronavirus: paniek over de Deltavariant is onterecht en zwaar overdreven‘ (!!!!)
En zie de links in dat bericht naar artikelen over de PCR test en de
bezuinigingen op de gezondheidszorg >> die bezuinigingen zijn de
reden voor de
Coronamaatregelen, die werden immers genomen daar er te weinig
ziekenhuisbedden, IC bedden en verpleegkundigen waren. Zoals ook in het bericht hierboven al gemeld: het aantal
verpleegkundigen is als de bedden sterk teruggelopen door wanbeleid van
de afbraakkabinetten Rutte 1, 2 en 3….. Zo waren er bij aantreden van
Rutte 1 nog 2.200 IC bedden, dat was bij aanvang van de Coronacrisis
teruggebracht naar 1.100 bedden….. Dus als je sterk bent
benadeeld door de Coronamaatregelen, weet je wie hiervoor
verantwoordelijk zijn!! Zie wat betreft dat bericht ook: ‘Coronavirus: artsen willen via rechtszaak tegen de staat COVID-19 van A-lijst krijgen, daar het een griepvirus zou zijn‘De video die oorspronkelijk in het artikel was te zien is
gecensureerd, tja je wilt natuurlijk niet dat de bevolking begrijpt
hoezeer men werd en wordt belazerd……
‘Coronabeslommeringen: ook na vaccinatie kan je het virus doorgeven, plus de zoveelste blunder van CDA minister de Jonge‘
Het na dit bericht gebrachte nieuws dat je niet besmettelijk bent na
vaccinatie, is achteraf gebeleken grote onzin te zijn en zou gebaseerd
zijn op een
foute interpretatie van een bericht uit de VS, lijkt me ook logisch daar
dr Fauci eerder al meldde dat gevaccineerden nog lang besmettelijk
blijven en zich aan de Coronamaatregelen dienen te houden, terwijl de
voormaligfe minister van Volksgezodnheid, CDA plork fde Jonge vorig jaar
zelf toegaf dat gevaccineerden niet veilig zijn…… (zie de
afbeelding met deze zwaar disfunctionerende kwezel in het blok met Pfizer links hierboven)
De denazificatie van Oekraïne, aangekondigd door de Russische president Putin, werd in het westen smalend afgedaan als propaganda om de militaire inval in dat land te legitimeren, ook het Witte Huis deed dit af als een belachelijke opmerking….. Terwijl het bekend is dat de VS Oekraïense neonazi bataljons heeft getraind, zelfs tot de inval van Rusland (ook Canadese wapeninstructeurs hebben zich hieraan schuldig gemaakt…..)…..
Voorts is het zeker dat de VS middels de CIA de staatsgreep tegen de democratische gekozen president Janoekovytsj heeft betaald (met 4 miljard dollar), de opstand die tot de staatsgreep leidde heeft georganiseerd en de uiteindelijke coup heeft georganiseerd en geregisseerd (waarbij men gebruikmaakte van neonazi-groeperingen), inclusief het betalen van huurmoordenaars die politieagenten en burgers doodschoten op het Maidanplein in Kiev (volgens sommigen waren deze moordenaars ook neonazi’s en dat zou me in het geheel niet verbazen).
Na de coup heeft de VS de corrupte neonazi Porosjenko aangesteld als ‘interim president’, vroeger noemden we dit beest bij de naam: juntaleider (dat ‘interim president’ moest de smerige lading >> een bloedige staatsgreep dan ook dekken en daarmee legitimeren…..)
De neonazi’s hebben daarna de illegale regering gecontroleerd en daarnaast kritische journalisten en politici belaagd dan wel zelfs vermoord….. Van vrije verkiezingen was en is geen sprake in Oekraïne, daar partijen zijn verboden die op grote steun kunnen rekenen van bijvoorbeeld mensen van Russische komaf….. Weet niet hoe jij hierover denkt, maar het uitsluiten van politieke partijen, geeft m.i. aan dat je met een dictatuur te maken hebt, zelfs met een fascistische dictatuur……
In het hierna weergegeven artikel van Mike Whitney, eerder gepubliceerd The Unz Review (ik nam het over van Information Clearing House), gaat deze verder in op het fascistische gehalte van Oekraïne en hoe de VS daar gebruik van heeft gemaakt en nog steeds maakt. Onder andere aandacht in dat artikel voor het feit dat het bureau van de Hoge Commissaris voor Mensenrechten (OHCHR) al in 2016 het neonazi-bataljon Azov, destijds al ‘bevorderd’ tot een officieel regiment van het Oekraïense leger, zich schuldig maakte aan oorlogsmisdaden als grootschalig plunderen, onwettige gijzeling en marteling (het noemen van moord op tegenstanders ging de OHCHR blijkbaar te ver, immers destijds had dit bataljon zicht al schuldig gemaakt aan het vermoorden van een groot aantal mensen…….)
Hier nog een paar ‘opmerkelijke zaken’ van de laatste paar dagen:
Gisteren vergistte een verslaggever van WDR 5 zich danig en week af van het platgetreden pad dat Rusland de door haar zelf ingestelde corridors onder vuur neemt, volgens deze figuur worden deze corridors onder vuur genomen, omdat Rusland ze niet afspreekt met de Oekraïense autoriteiten…… Kortom deze sufferd gaf toe dat het Oekraïense leger deze corridors onder vuur neemt!!
Men maakt zich in de reguliere westerse media en politiek druk over aanvallen van burgerdoelen door Rusland. Voor zover dat ook maar iets met de waarheid te maken heeft, immers neonazi-bataljons als Azov hebben er totaal geen moeite mee om de eigen burgers aan te vallen en de schuld daarvoor in de schoenen van Rusland te schuiven….. Wat betreft het aanvallen van burgerdoelen, melden westerse media NB keer op keer over burgers die hun appartementencomplexen veranderen in militaire aanvalsposten, dit door opgeworpen versperringen, het maken van tankvallen en versterkingen van die complexen om van daaruit Russen aan te kunnen vallen, dit zou volgens zeggen in alle Oekraïense steden het geval zijn…… Ofwel hoe kan je van een woonwijk een militair doel maken??!!!
Dan te bedenken dat men in de VS de stormloop op het Capitol van 6 januari 2021 toeschrijft aan nazi en ander tuig, terwijl het Witte Huis, het Pentagon en de CIA er geen moeite mee hebben om Oekraiense neonazi’s te trainen en te bewapenen als ze maar tegen Russen of mensen van Russische komaf vechten……. Hoe hypocriet en ziek wil je het hebben??
Hare kwaadaardigheid minister Kaag misbruikt de situatie in Oekraïne om te pleiten voor het inleveren van Nederlandse soevereiniteit ten gunste van de EU (ofwel van de grote EU staten Frankrijk, Duitsland, Polen e.a., echter waar de eerste 2 verreweg de belangrijkste zijn….)…. Vanmorgen hoorde ik in MAX Nieuwsweekend de potsierlijke kwast en meer dan waardeloze ‘politiek deskundige’ Kees Boonman* stellen dat het grootste deel van de Nederlanders achter het inleveren van soevereiniteit zou staan. ‘Iedereen zou dit wel begrijpen’ gezien de ‘Russische agressie’, aldus de fantast, die er geen moeite mee heeft als de VS weer eens een land naar god bombardeert….. Uiteraard heeft deze waardeloze sufferd geen begrip voor de positie van Rusland dat bijna het jaarrond agressieve NAVO oefeningen ziet langs haar westgrens en territoriale wateren (zelfs gericht op het binnenvallen van Russische grondgebied)…… Of wat dacht je van het zogenaamde VS raketschild in Polen en Roemenië, waarvan de VS de raketten in een mum van tijd kan veranderen in aanvalsraketten met al aanwezige meerdere kernkoppen, waarmee de VS grote Russische steden kan vernietigen en dat over afstanden die waren verboden in het INF-verdrag (niet voor niets ook dat de VS dit verdrag heeft opgezegd, zogenaamd vanwege een nieuwe generatie Russische kernraketten, die de VS op meerdere uitnodigingen van Rusland weigerde te inspecteren, inspecties zodat de VS kon zien dat deze raketten het INF-verdrag niet schenden >> ook al een zaak waarvoor de westerse politici en media geen aandacht hadden of hebben…..)
In het WDR 5 nieuws van vanmiddag o.a. het bericht dat de Duitse autoriteiten ongerust zijn over de aanvallen op mensen van Russische komaf, aanvallen op hun winkels en zelfs de aanvallen waar kinderen van deze mensen op school mee te maken hebben……. Ofwel dezelfde autoriteiten hebben Rusland uit en te na gedemoniseerd, waarbij men de Russische burgers heeft verweten niet tegen de Russische acties in Oekraïne te hebben uitgesproken, ofwel dan moet je wel achter die acties staan en ben je volgens deze autoriteiten blijkbaar vogelvrij verklaard…….
Lees het artikel van Whitney en geeft het ajb door, de hoogste tijd dat het westen stopt met haar vreselijke anti-Russische propaganda en dat deze wordt doorgeprikt, zonder dat de westerse politiek en reguliere media ook maar met één letter wijzen op de terechte angsten van Rusland en haar wil om Oekraïne te denazificeren…….. Het is in het westen al zo zot dat het neonazi-bataljon Azov openlijk mag worden geroemd, terwijl de ploerten van dat bataljon zich achter de nazi-Duitse aanval tegen Rusland hebben geschaard tijdens de Tweede Wereldoorlog (WOII) en de leden van dat bataljon zich bedienen van nazi-emblemen en geen moeite hebben met de Hitler groet…… Vergeet niet dat de strijd van Rusland tegen nazi-Duitsland aan 20 miljoen Russen het leven heeft gekost……
Je kan het volgende artikel vertalen met de vertaalapp van Information Clearing House, te vinden onder het volgende artikel, klik dan op ‘dutch’, of met deze vertaalapp, die snel werkt en de vertaling is van een redelijk goede kwaliteit. Kopieer het artikel en plaats het links in de app, je ziet rechts Italiaans staan als je daar op klikt kan je kiezen voor Nederlands.
(On the top right hand side of this page you can choose for a translation in the language of your choice: choose ‘Engels’ [english] so you can recognise your own language [the Google translation is first in dutch, a language most people don’t understand, while on the other hand most people recognise there language translated in english])
“I have spoken with my Western colleagues about denazification. They say:” What’s the problem? You also have radical nationalists, don’t you?” Yes, we do, but we don’t have them in our government like Ukraine. And we don’t have thousands of people marching in the streets with torches and swastikas like Nazi Germany in the 1930s? And we don’t praise the men who killed Russians, Jews, and Poles during the war. But in Ukraine, they do.”Vladimir Putin, Russian President
The United States has been arming and training far-right militants that are the ideological descendants of Nazi war criminals that were directly involved in the mass-extermination of Jews, Slavs and Gypsies during the Second World War. These Ukrainian storm troopers are among the most vicious and malignant combatants Washington has ever employed to implement its foreign policy agenda. Naturally, Washington sees these fascist-zealots as mere pawns in its proxy war on Russia. Even so, the ‘alliance of convenience’ does not diminish the fact that Uncle Sam is now in bed with right-wing militants whose spiritual leader, Adolph Hitler, was responsible for the deaths of tens of millions of people as well as the destruction of large parts of Europe and Russia. Check out this clip from an article titled “Can Ukraine have a ‘Nazi problem’ with a Jewish president?:
“Ukraine really does have a far-right problem, and it’s not a fiction of Kremlin propaganda. And it’s well past time to talk about it,” explained journalist and expert on the Ukrainian far right, Michael Colborne.
The most known neo-Nazi group on Ukraine’s far right is the Azov movement. The movement grew out of the Azov Regiment (originally a Battalion), formed in the chaos of war in early 2014.
It was formed by a “ragtag group of far-right thugs, football hooligans and international hangers-on, including dozens of Russian citizens,” said Colborne, who wrote a book on the movement.”(“Can Ukraine have a ‘Nazi problem’ with a Jewish president?”, Jewish Unpacked)
While Russian President Vladimir Putin is committed to removing Ukraine’s Nazis from power, it is uncertain how he will do so. Self-identified fascists now hold positions of authority in the military, the government and the Security Services. They have also been the driving force behind the 8 year-long siege of the Donbass region in east Ukraine that is mainly inhabited by ethnic Russians. The militants’ hatred for their Slavic brothers suggests that Hitler’s racial theories are being ruthlessly applied in 21st Century Europe. Here’s an excerpt from an article at The Saker Blog:
“Since the Western-backed coup in Kiev in 2014, political organizations associated with neo-Nazis infiltrated Ukrainian mainstream politics as the Ukrainian government sent troops to try to crush the Donbass uprisings by force.
As Ukraine waged war against breakaway forces in the Donetsk and Lugansk People’s Republics, the Neo-Nazi Groups in Ukraine gained notoriety for their belligerent rhetoric towards the population of the country’s east, as well as for eagerly participating in the civil war….
The (Azov Battalion’s) first commander was right-wing nationalist Andriy Biletsky, who led the paramilitary national socialist group called “Patriot of Ukraine” and was the founder of a neo-Nazi group, the Social-National Assembly (SNA) in 2008. In 2010, Biletsky, a former parliamentarian, apparently said that Ukraine was meant to “lead the white races of the world in a final crusade … against Semite-led Untermenschen (subhumans) ”by reports in a spate of Western mainstream outlets.” (“Ukrainian bad guys and a fair Russian response“, Batko Milacic for the Saker Blog)
Readers should take a minute to savor Washington’s duplicity on this matter, after all, while the Biden administration and the entire MSM was denouncing the January 6 protestors as “racists” and “white supremacists”, the US government was busy arming and training “white crusader” Nazis to carry out its war on Russia. What’s that all about? If there was an Academy Award for hypocrisy, Uncle Sam would be the hands-down favorite. Here’s more from the same piece:
“Azov took part in subsequent hostilities in Donbass and was incorporated into the National Guard of Ukraine in November 2014, although its members continued to wear neo-Nazi and SS-like symbols and regalia and openly express neo-Nazi views. Their logo echoes the Wolfsangel, one of the original symbols used by the 2nd SS Panzer Division Das Reich. Representatives of the Azov Battalion, however, have claimed their symbol is an abbreviation for the slogan “National Idea” in Ukrainian.
Ukrainian authorities did not bother to conceal the fact that in 2014, Azov comprised neo-Nazi-leaning volunteers from countries such as Sweden, Italy, France, Belarus, Canada, and Slovenia.
Despite the adoption of the 2015 Minsk Accords that were aimed at ending the civil war by reintegrating the Donbass into Ukraine in exchange for constitutionally-guaranteed autonomy, Kiev refused to implement a peace deal. Azov members took an active part in Donbass hostilities.
In 2016, the Office of the UN High Commissioner for Human Rights (OHCHR) accused the Azov Battalion, officially upgraded to a regiment in January 2015, of committing war crimes such as mass looting, unlawful detention, and torture. Currently, the Azov “Special Operations Detachment” is engaged in the Ukrainian army’s counter-reconnaissance and special weapons operations.
The Russian Investigative Committee has opened a criminal case against a number of fighters from Azov units for crimes such as kidnapping, torture, use of prohibited means, and methods of warfare.” (“Ukrainian bad guys and a fair Russian response”, Batko Milacic for the Saker Blog)
Again, these are not your garden-variety, right-wing militants. These are full-fledged, battle-hardened Nazi storm troopers that have engaged in all-manner of illegal and sadistic activities including “the mass killing of prisoners, the concealment of corpses in mass graves and the systematic use of physical and psychological torture techniques.” And while they are lavishly supported by the United States, they oppose everything that America claims to stand for. They are universally opposed to liberal democracy, parliamentary government and racial equality. Instead, they advocate social regimentation, autocratic rule and glorification of the state. Race is very much at the core of Nazi Doctrine. (which may explain the animus these fascist groups have for the ethnic Russians in the east.) A few quotes from Hitler’s manifesto Mein Kampt help to illustrate this point:
“A stronger race will drive out the weaker ones, for the vital urge in its ultimate form will break down the absurd barriers of the so-called humanity of individuals to make way for the humanity of nature which destroys the weak to give their place to the strong.”
“Blood sin and desecration of the race are the original sin of this world and the end of a humanity that surrenders to it.” (“Adolf Hitler, Quotes on Race”, quotetab)
The above quotes provide a window into the ideology that was used to justify a world war against “inferior people” who were seen as expendable in the eyes of their Aryan overlords. Why– you may ask– is the US supporting the adherents of this same fiendish dogma in Ukraine today?
We can’t answer that, but here’s more background from an article by Monseigneur Carlo Maria Vigano:
“Neo-Nazi movements engaged in military and paramilitary actions operate freely in Ukraine, often with the official support of public institutions. These include the following: Stepan Bandera’s Organization of Ukrainian Nationalists (OUN), a movement with a Nazi, anti-Semitic and racist matrix already active in Chechnya and which is part of the Right Sector, an association of far-right movements formed at the time of the Euromaidan coup in 2013/2014; the Ukrainian Insurgent Army (UPA); the UNA/UNSO, paramilitary wing of the far-right political party Ukraine National Assembly; the Korchinsky Brotherhood, which offered protection in Kiev to ISIS members; Misanthropic Vision (MD), a neo-Nazi network spread across 19 countries that publicly incites terrorism, extremism and hatred against Christians, Muslims, Jews, Communists, homosexuals, Americans and people of color.
It should be remembered that the government has given explicit support to these extremist organizations both by sending the presidential guard to the funerals of their representatives, as well as by supporting the Azov Battalion, a paramilitary organization that is officially part of the Ukrainian Army under the new name of Azov Special Operations Regiment and organized into the National Guard. ..
In March 2015, Ukrainian Interior Minister Arsen Avakov announced that the Azov Battalion would be one of the first units to be trained by US Army troops, as part of their Operation Fearless Guard training mission. … “We have been training these guys for eight years now. They are really good fighters. That’s where the Agency’s program could have a serious impact.” (“Declaration of Msgr. Carlo Maria Viganò on the Russia-Ukraine Crisis”, marcotosatti.com)
Vigano is right, the US has been providing combat training to Ukrainian Nazis and other far-right groups in secret camps since 2015. These ultra nationalist militias will now pass along these same skills to tens of thousands of other like-minded militants increasing the global spread of fascism by many orders of magnitude. Here’s more from an article at Jacobin Magazine:
“Not just the Ukrainian far right, but neo-fascist forces from all over the world, including the US and Europe, will now receive combat experience with the most advanced weapons in the world. They will also be able to continue developing their international networks, to which the Ukrainian far right, and especially the Azov Battalion, have long been central…
… since 2015, the CIA has been secretly training forces in Ukraine to serve as “insurgent leaders,” in the words of one former intelligence official, in case Russia ends up invading the country. Current officials are claiming the training is purely for intelligence collection, but the former officials Yahoo! spoke to said the program involved training in firearms, “cover and move,” and camouflage, among other things.
Given the facts, there’s a good chance that the CIA is training actual, literal Nazis as part of this effort. The year the program started, 2015, also happened to be the same year that Congress passed a spending bill that featured hundreds of millions of dollars’ worth of economic and military support for Ukraine… (“The CIA May Be Breeding Nazi Terror in Ukraine”, Branko Marcetic, Jacobin Magazine)
But why has the United States gone to so much trouble to arm and train these combatants when it appears that the Russian army is clearly going to win the war?
The plan to defeat Russia was never intended to succeed in the initial phase of the conflict, but to lay the groundwork for a bloody and protracted insurgency fought by these same CIA-trained paramilitaries who now act as Uncle Sam’s Nazi warriors. Here’s the story from Yahoo News:
“The CIA is overseeing a secret intensive training program in the U.S. for elite Ukrainian special operations forces and other intelligence personnel, according to five former intelligence and national security officials familiar with the initiative. The program, which started in 2015, is based at an undisclosed facility in the Southern U.S., according to some of those officials….
The training, which has included “tactical stuff,” is “going to start looking pretty offensive if Russians invade Ukraine,” said the former official. One person familiar with the program put it more bluntly. “The United States is training an insurgency,” said a former CIA official, adding that the program has taught the Ukrainians how “to kill Russians.”
Though the agency’s paramilitary resources have been otherwise stretched thin in Afghanistan and on other counterterrorism missions, the U.S.-based training program has been a “high priority” for the CIA since its Obama-era inception, said the former senior intelligence official…. The Biden administration has reportedly assembled a task force to determine how the CIA and other U.S. agencies could support a Ukrainian insurgency, should Russia launch a large-scale incursion.
“If the Russians invade, those [graduates of the CIA programs] are going to be your militia, your insurgent leaders,” said the former senior intelligence official. “We’ve been training these guys now for eight years. They’re really good fighters. That’s where the agency’s program could have a serious impact.”
Both U.S. and Ukrainian officials believe that Ukrainian forces will not be able to withstand a large-scale Russian incursion, according to former U.S. officials. But representatives from both countries also believe that Russia won’t be able to hold on to new territory indefinitely because of stiff resistance from Ukrainian insurgents, according to former officials.
If the Russians launch a new invasion, “there’s going to be people who make their life miserable,” said the former senior intelligence official. The CIA-trained paramilitaries “will organize the resistance” using the specialized training they’ve received.
The United States has been arming and training Ukrainian fascist combatants in secret locations.
The CIA training program began in 2015 which suggests there must have been a plan for goading Russia into invading. Nothing would have been left to chance. Strategic planners must have settled on what provocations they would use. (like the threat of NATO membership)
Official Washington never thought the Ukrainian army could prevail against a conflict with the Russian Army, which suggests that the media’s stories about “the brave Ukrainian resistance” are reckless propaganda designed to garner greater public support.
The country of Ukraine and the Ukrainian people are of no interest to the United States. Ukraine is only valuable in as much as it provides a staging ground (and the manpower) for Washington to prosecute a war against Russia.
The clear strategic objective of the CIA program is to create an “Afghanistan-type” quagmire for Russia that will deplete its resources, inflict massive reputational damage, and kill as many Russian servicemen as possible.
The ultimate goal of the CIA-generated insurgency is to destroy the Russian economy, isolate the Russian leadership, and send home as many Russian boys in body-bags as possible in order to affect a regime change that will replace arch-rival Putin with a compliant stooge like Ukrainian Puppet Zelensky.
All the evidence suggests that the developments on the ground– including the luring of Russian troops into Ukraine– is part of a long-standing strategic plan to prevent the economic integration of Russia and Europe in order to control China’s development and preserve US hegemony into the next century. Thus, current US foreign policy can be summarized in just 10 words:
“We’ll deal with Russia first, then move on to China.
*Boonman ziet het vooral als zijn taak om de disfunctionerende VVD premier Rutte en diens kabinetten te prijzen en dat durft zich ook nog journalist te noemen…….
Foto van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze hebben de laatste 8 jaar de steden en dorpen van de zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al hebben ze alsnog veel slachtoffers gemaakt onder burgers in die staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die hieronder is te vinden.
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘ (!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO trouwens de normaalste zaak van de wereld: dat steunen van fascisten…..) En dan te bedenken dat premier Rutte en minister van Buitenlandse Zaken Hoekstra onlangs een krans hebben gelegd bij een monument voor met name omgekomen neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En nogmaals: het is de allerhoogste tijd dat journalist Julian Assange wordt vrijgelaten uit de smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS (toegegeven in officiële gelekte documenten van de VS!!!)……. Het is zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze documenten plus beeldmateriaal zijn te vinden in WikiLeaks!!
De denazificatie van Oekraïne, aangekondigd door de Russische president Putin, werd in het westen smalend afgedaan als propaganda om de militaire inval in dat land te legitimeren, ook het Witte Huis deed dit af als een belachelijke opmerking….. Terwijl het bekend is dat de VS Oekraïense neonazi bataljons heeft getraind, zelfs tot de inval van Rusland (ook Canadese wapeninstructeurs hebben zich hieraan schuldig gemaakt…..)…..
Voorts is het zeker dat de VS middels de CIA de staatsgreep tegen de democratische gekozen president Janoekovytsj heeft betaald (met 4 miljard dollar), de opstand die tot de staatsgreep leidde heeft georganiseerd en de uiteindelijke coup heeft georganiseerd en geregisseerd (waarbij men gebruikmaakte van neonazi-groeperingen), inclusief het betalen van huurmoordenaars die politieagenten en burgers doodschoten op het Maidanplein in Kiev (volgens sommigen waren deze moordenaars ook neonazi’s en dat zou me in het geheel niet verbazen).
Na de coup heeft de VS de corrupte neonazi Porosjenko aangesteld als ‘interim president’, vroeger noemden we dit beest bij de naam: juntaleider (dat ‘interim president’ moest de smerige lading >> een bloedige staatsgreep dan ook dekken en daarmee legitimeren…..)
De neonazi’s hebben daarna de illegale regering gecontroleerd en daarnaast kritische journalisten en politici belaagd dan wel zelfs vermoord….. Van vrije verkiezingen was en is geen sprake in Oekraïne, daar partijen zijn verboden die op grote steun kunnen rekenen van bijvoorbeeld mensen van Russische komaf….. Weet niet hoe jij hierover denkt, maar het uitsluiten van politieke partijen, geeft m.i. aan dat je met een dictatuur te maken hebt, zelfs met een fascistische dictatuur……
In het hierna weergegeven artikel van Mike Whitney, eerder gepubliceerd The Unz Review (ik nam het over van Information Clearing House), gaat deze verder in op het fascistische gehalte van Oekraïne en hoe de VS daar gebruik van heeft gemaakt en nog steeds maakt. Onder andere aandacht in dat artikel voor het feit dat het bureau van de Hoge Commissaris voor Mensenrechten (OHCHR) al in 2016 het neonazi-bataljon Azov, destijds al ‘bevorderd’ tot een officieel regiment van het Oekraïense leger, zich schuldig maakte aan oorlogsmisdaden als grootschalig plunderen, onwettige gijzeling en marteling (het noemen van moord op tegenstanders ging de OHCHR blijkbaar te ver, immers destijds had dit bataljon zicht al schuldig gemaakt aan het vermoorden van een groot aantal mensen…….)
Hier nog een paar ‘opmerkelijke zaken’ van de laatste paar dagen:
Gisteren vergistte een verslaggever van WDR 5 zich danig en week af van het platgetreden pad dat Rusland de door haar zelf ingestelde corridors onder vuur neemt, volgens deze figuur worden deze corridors onder vuur genomen, omdat Rusland ze niet afspreekt met de Oekraïense autoriteiten…… Kortom deze sufferd gaf toe dat het Oekraïense leger deze corridors onder vuur neemt!!
Men maakt zich in de reguliere westerse media en politiek druk over aanvallen van burgerdoelen door Rusland. Voor zover dat ook maar iets met de waarheid te maken heeft, immers neonazi-bataljons als Azov hebben er totaal geen moeite mee om de eigen burgers aan te vallen en de schuld daarvoor in de schoenen van Rusland te schuiven….. Wat betreft het aanvallen van burgerdoelen, melden westerse media NB keer op keer over burgers die hun appartementencomplexen veranderen in militaire aanvalsposten, dit door opgeworpen versperringen, het maken van tankvallen en versterkingen van die complexen om van daaruit Russen aan te kunnen vallen, dit zou volgens zeggen in alle Oekraïense steden het geval zijn…… Ofwel hoe kan je van een woonwijk een militair doel maken??!!!
Dan te bedenken dat men in de VS de stormloop op het Capitol van 6 januari 2021 toeschrijft aan nazi en ander tuig, terwijl het Witte Huis, het Pentagon en de CIA er geen moeite mee hebben om Oekraiense neonazi’s te trainen en te bewapenen als ze maar tegen Russen of mensen van Russische komaf vechten……. Hoe hypocriet en ziek wil je het hebben??
Hare kwaadaardigheid minister Kaag misbruikt de situatie in Oekraïne om te pleiten voor het inleveren van Nederlandse soevereiniteit ten gunste van de EU (ofwel van de grote EU staten Frankrijk, Duitsland, Polen e.a., echter waar de eerste 2 verreweg de belangrijkste zijn….)…. Vanmorgen hoorde ik in MAX Nieuwsweekend de potsierlijke kwast en meer dan waardeloze ‘politiek deskundige’ Kees Boonman* stellen dat het grootste deel van de Nederlanders achter het inleveren van soevereiniteit zou staan. ‘Iedereen zou dit wel begrijpen’ gezien de ‘Russische agressie’, aldus de fantast, die er geen moeite mee heeft als de VS weer eens een land naar god bombardeert….. Uiteraard heeft deze waardeloze sufferd geen begrip voor de positie van Rusland dat bijna het jaarrond agressieve NAVO oefeningen ziet langs haar westgrens en territoriale wateren (zelfs gericht op het binnenvallen van Russische grondgebied)…… Of wat dacht je van het zogenaamde VS raketschild in Polen en Roemenië, waarvan de VS de raketten in een mum van tijd kan veranderen in aanvalsraketten met al aanwezige meerdere kernkoppen, waarmee de VS grote Russische steden kan vernietigen en dat over afstanden die waren verboden in het INF-verdrag (niet voor niets ook dat de VS dit verdrag heeft opgezegd, zogenaamd vanwege een nieuwe generatie Russische kernraketten, die de VS op meerdere uitnodigingen van Rusland weigerde te inspecteren, inspecties zodat de VS kon zien dat deze raketten het INF-verdrag niet schenden >> ook al een zaak waarvoor de westerse politici en media geen aandacht hadden of hebben…..)
In
het WDR 5 nieuws van vanmiddag o.a. het bericht dat de Duitse
autoriteiten ongerust zijn over de aanvallen op mensen van Russische
komaf, aanvallen op hun winkels en zelfs de aanvallen waar kinderen van deze
mensen op school mee te maken hebben……. Ofwel dezelfde autoriteiten
hebben Rusland uit en te na gedemoniseerd, waarbij men de Russische
burgers heeft verweten niet tegen de Russische acties in Oekraïne te
hebben uitgesproken, ofwel dan moet je wel achter die acties staan en
ben je volgens deze autoriteiten blijkbaar vogelvrij verklaard…….
Lees het artikel van Whitney en geeft het ajb door, de hoogste tijd dat het westen stopt met haar vreselijke anti-Russische propaganda en dat deze wordt doorgeprikt, zonder dat de westerse politiek en reguliere media ook maar met één letter wijzen op de terechte angsten van Rusland en haar wil om Oekraïne te denazificeren…….. Het is in het westen al zo zot dat het neonazi-bataljon Azov openlijk mag worden geroemd, terwijl de ploerten van dat bataljon zich achter de nazi-Duitse aanval tegen Rusland hebben geschaard tijdens de Tweede Wereldoorlog (WOII) en de leden van dat bataljon zich bedienen van nazi-emblemen en geen moeite hebben met de Hitler groet…… Vergeet niet dat de strijd van Rusland tegen nazi-Duitsland aan 20 miljoen Russen het leven heeft gekost……
Je kan het volgende artikel vertalen met de vertaalapp van Information Clearing House, te vinden onder het volgende artikel, klik dan op ‘dutch’, of met deze vertaalapp,
die snel werkt en de vertaling is van een redelijk goede
kwaliteit. Kopieer
het artikel en plaats het links in de app, je ziet rechts Italiaans
staan als je daar op klikt kan je kiezen voor Nederlands.
(On
the top right hand side of this page you can choose for a translation
in the language of your choice: choose ‘Engels’
[english] so you can recognise your own language [the Google
translation is first in dutch, a language most people don’t
understand, while on the other hand most people recognise there
language translated in english])
“I have spoken with
my Western colleagues about denazification.
They say:” What’s the problem? You also have
radical nationalists, don’t you?” Yes, we
do, but we don’t have them in our government
like Ukraine. And we don’t have thousands
of people marching in the streets with
torches and swastikas like Nazi Germany in
the 1930s? And we don’t praise the men who
killed Russians, Jews, and Poles during the
war. But in Ukraine, they do.” Vladimir Putin, Russian President
The United States has
been arming and training far-right militants
that are the ideological descendants of Nazi war
criminals that were directly involved in the
mass-extermination of Jews, Slavs and Gypsies
during the Second World War. These Ukrainian
storm troopers are among the most vicious and
malignant combatants Washington has ever
employed to implement its foreign policy agenda. Naturally, Washington sees these
fascist-zealots as mere pawns in its proxy war
on Russia. Even so, the ‘alliance of
convenience’ does not diminish the fact that
Uncle Sam is now in bed with right-wing
militants whose spiritual leader, Adolph Hitler,
was responsible for the deaths of tens of
millions of people as well as the destruction of
large parts of Europe and Russia. Check out this
clip from an article titled “Can Ukraine have a
‘Nazi problem’ with a Jewish president?:
“Ukraine really
does have a far-right problem, and it’s not
a fiction of Kremlin propaganda. And
it’s well past time to talk about it,”
explained journalist and expert on the
Ukrainian far right, Michael Colborne.
The most known
neo-Nazi group on Ukraine’s far right is the
Azov movement. The movement grew out of the
Azov Regiment (originally a Battalion),
formed in the chaos of war in early 2014.
It was formed by a
“ragtag group of far-right thugs, football
hooligans and international hangers-on,
including dozens of Russian citizens,” said
Colborne, who wrote a book on the
movement.”(“Can
Ukraine have a ‘Nazi problem’ with a Jewish
president?”, Jewish Unpacked)
While Russian President
Vladimir Putin is committed to removing
Ukraine’s Nazis from power, it is uncertain how
he will do so. Self-identified fascists now hold
positions of authority in the military, the
government and the Security Services. They have
also been the driving force behind the 8
year-long siege of the Donbass region in east
Ukraine that is mainly inhabited by ethnic
Russians. The militants’ hatred for their Slavic
brothers suggests that Hitler’s racial theories
are being ruthlessly applied in 21st Century
Europe. Here’s an excerpt from an article at The
Saker Blog:
“Since the
Western-backed coup in Kiev in 2014,
political organizations associated with
neo-Nazis infiltrated Ukrainian mainstream
politics as the Ukrainian government sent
troops to try to crush the Donbass uprisings
by force.
As Ukraine waged war
against breakaway forces in the Donetsk and
Lugansk People’s Republics, the Neo-Nazi
Groups in Ukraine gained notoriety for their
belligerent rhetoric towards the population
of the country’s east, as well as for
eagerly participating in the civil war….
The (Azov
Battalion’s) first commander was right-wing
nationalist Andriy Biletsky, who led the
paramilitary national socialist group called
“Patriot of Ukraine” and was the founder of
a neo-Nazi group, the Social-National
Assembly (SNA) in 2008. In 2010, Biletsky, a
former parliamentarian, apparently said that Ukraine was meant to “lead the white
races of the world in a final crusade …
against Semite-led Untermenschen (subhumans) ”by reports in a spate of Western
mainstream outlets.” (“Ukrainian
bad guys and a fair Russian response“,
Batko Milacic for the Saker Blog)
Readers should take a
minute to savor Washington’s duplicity on this
matter, after all, while the Biden
administration and the entire MSM was denouncing
the January 6 protestors as “racists” and “white
supremacists”, the US government was busy arming
and training “white crusader” Nazis to carry out
its war on Russia. What’s that all about? If
there was an Academy Award for hypocrisy, Uncle
Sam would be the hands-down favorite. Here’s
more from the same piece:
“Azov took part in
subsequent hostilities in Donbass and was
incorporated into the National Guard of
Ukraine in November 2014, although its
members continued to wear neo-Nazi and
SS-like symbols and regalia and openly
express neo-Nazi views. Their logo echoes
the Wolfsangel, one of the original symbols
used by the 2nd SS Panzer Division Das Reich.
Representatives of the Azov Battalion,
however, have claimed their symbol is an
abbreviation for the slogan “National Idea”
in Ukrainian.
Ukrainian
authorities did not bother to conceal the
fact that in 2014, Azov comprised
neo-Nazi-leaning volunteers from countries
such as Sweden, Italy, France, Belarus,
Canada, and Slovenia.
Despite the adoption
of the 2015 Minsk Accords that were
aimed at ending the civil war by
reintegrating the Donbass into Ukraine in
exchange for constitutionally-guaranteed
autonomy, Kiev refused to implement a
peace deal. Azov members took an active
part in Donbass hostilities.
In 2016, the Office
of the UN High Commissioner for Human Rights
(OHCHR) accused the Azov Battalion,
officially upgraded to a regiment in January
2015, of committing war crimes such as
mass looting, unlawful detention, and
torture. Currently, the Azov “Special
Operations Detachment” is engaged in the
Ukrainian army’s counter-reconnaissance and
special weapons operations.
The Russian
Investigative Committee has opened a
criminal case against a number of fighters
from Azov units for crimes such as
kidnapping, torture, use of prohibited
means, and methods of warfare.” (“Ukrainian
bad guys and a fair Russian response”,
Batko Milacic for the Saker Blog)
Again, these are not your
garden-variety, right-wing militants. These are
full-fledged, battle-hardened Nazi storm
troopers that have engaged in all-manner of
illegal and sadistic activities including “the
mass killing of prisoners, the concealment of
corpses in mass graves and the systematic use of
physical and psychological torture techniques.” And while they are lavishly supported by the
United States, they oppose everything that
America claims to stand for. They are
universally opposed to liberal democracy,
parliamentary government and racial equality.
Instead, they advocate social regimentation,
autocratic rule and glorification of the state.
Race is very much at the core of Nazi Doctrine.
(which may explain the animus these fascist
groups have for the ethnic Russians in the
east.) A few quotes from Hitler’s manifesto Mein
Kampt help to illustrate this point:
“A stronger race
will drive out the weaker ones, for the
vital urge in its ultimate form will break
down the absurd barriers of the so-called
humanity of individuals to make way for
the humanity of nature which destroys the
weak to give their place to the strong.”
“Blood sin and
desecration of the race are the original sin
of this world and the end of a humanity that
surrenders to it.” (“Adolf
Hitler, Quotes on Race”, quotetab)
The above quotes provide
a window into the ideology that was used to
justify a world war against “inferior people”
who were seen as expendable in the eyes of their
Aryan overlords. Why– you may ask– is the US
supporting the adherents of this same fiendish
dogma in Ukraine today?
We can’t answer that, but
here’s more background from an article by
Monseigneur Carlo Maria Vigano:
“Neo-Nazi
movements engaged in military and
paramilitary actions operate freely in
Ukraine, often with the official support of
public institutions. These include the
following: Stepan Bandera’s Organization of
Ukrainian Nationalists (OUN), a movement
with a Nazi, anti-Semitic and racist matrix
already active in Chechnya and which is part
of the Right Sector, an association of
far-right movements formed at the time of
the Euromaidan coup in 2013/2014; the
Ukrainian Insurgent Army (UPA); the
UNA/UNSO, paramilitary wing of the far-right
political party Ukraine National Assembly;
the Korchinsky Brotherhood, which offered
protection in Kiev to ISIS members;
Misanthropic Vision (MD), a neo-Nazi network
spread across 19 countries that publicly
incites terrorism, extremism and hatred
against Christians, Muslims, Jews,
Communists, homosexuals, Americans and
people of color.
It should be
remembered that the government has given
explicit support to these extremist
organizations both by sending the
presidential guard to the funerals of their
representatives, as well as by supporting
the Azov Battalion, a paramilitary
organization that is officially part of the
Ukrainian Army under the new name of Azov
Special Operations Regiment and organized
into the National Guard. ..
In March 2015,
Ukrainian Interior Minister Arsen Avakov
announced that the Azov Battalion would be
one of the first units to be trained by US
Army troops, as part of their Operation
Fearless Guard training mission. … “We have
been training these guys for eight years
now. They are really good fighters. That’s
where the Agency’s program could have a
serious impact.” (“Declaration
of Msgr. Carlo Maria Viganò on the
Russia-Ukraine Crisis”,
marcotosatti.com)
Vigano is right, the US
has been providing combat training to Ukrainian
Nazis and other far-right groups in secret camps
since 2015. These ultra nationalist militias
will now pass along these same skills to tens of
thousands of other like-minded militants
increasing the global spread of fascism by many
orders of magnitude. Here’s more from an article
at Jacobin Magazine:
“Not just the
Ukrainian far right, but neo-fascist forces
from all over the world, including the US
and Europe, will now receive combat
experience with the most advanced weapons in
the world. They will also be able to
continue developing their international
networks, to which the Ukrainian far right,
and especially the Azov Battalion, have long
been central…
… since 2015, the CIA
has been secretly training forces in Ukraine
to serve as “insurgent leaders,” in the
words of one former intelligence official,
in case Russia ends up invading the country.
Current officials are claiming the training
is purely for intelligence collection, but
the former officials Yahoo! spoke to said
the program involved training in firearms,
“cover and move,” and camouflage, among
other things.
Given the facts,
there’s a good chance that the CIA is
training actual, literal Nazis as part of
this effort. The year the program started,
2015, also happened to be the same year that
Congress passed a spending bill that
featured hundreds of millions of dollars’
worth of economic and military support for
Ukraine… (“The
CIA May Be Breeding Nazi Terror in Ukraine”,
Branko Marcetic, Jacobin Magazine)
But why has the United
States gone to so much trouble to arm and train
these combatants when it appears that the
Russian army is clearly going to win the war?
The plan to defeat
Russia was never intended to succeed in the
initial phase of the conflict, but to lay the
groundwork for a bloody and protracted
insurgency fought by these same CIA-trained
paramilitaries who now act as Uncle Sam’s Nazi
warriors. Here’s the story from Yahoo News:
“The CIA is
overseeing a secret intensive training
program in the U.S. for elite Ukrainian
special operations forces and other
intelligence personnel, according to five
former intelligence and national security
officials familiar with the initiative. The
program, which started in 2015, is based at
an undisclosed facility in the Southern
U.S., according to some of those officials….
The training, which
has included “tactical stuff,” is “going to
start looking pretty offensive if Russians
invade Ukraine,” said the former official.
One person familiar with the program put it
more bluntly. “The United States is
training an insurgency,” said a former CIA
official, adding that the program has taught
the Ukrainians how “to kill Russians.”
Though the
agency’s paramilitary resources have been
otherwise stretched thin in Afghanistan and
on other counterterrorism missions, the
U.S.-based training program has been a “high
priority” for the CIA since its Obama-era
inception, said the former senior
intelligence official…. The Biden
administration has reportedly assembled a
task force to determine how the CIA and
other U.S. agencies could support a
Ukrainian insurgency, should Russia launch a
large-scale incursion.
“If the Russians
invade, those [graduates of the CIA
programs] are going to be your militia, your
insurgent leaders,” said the former senior
intelligence official. “We’ve been training
these guys now for eight years. They’re
really good fighters. That’s where the
agency’s program could have a serious
impact.”
Both U.S. and
Ukrainian officials believe that
Ukrainian forces will not be able to
withstand a large-scale Russian incursion,
according to former U.S. officials. But
representatives from both countries also
believe that Russia won’t be able to hold on
to new territory indefinitely because of
stiff resistance from Ukrainian insurgents,
according to former officials.
If the Russians
launch a new invasion, “there’s going to be
people who make their life miserable,”
said the former senior intelligence
official. The CIA-trained paramilitaries
“will organize the resistance” using the
specialized training they’ve received.
The United States has been arming and
training Ukrainian fascist combatants in
secret locations.
The CIA training program began in
2015 which suggests there must have been a
plan for goading Russia into invading.
Nothing would have been left to chance.
Strategic planners must have settled on what
provocations they would use. (like the
threat of NATO membership)
Official Washington never thought the
Ukrainian army could prevail against a
conflict with the Russian Army, which
suggests that the media’s stories about “the
brave Ukrainian resistance” are reckless
propaganda designed to garner greater public
support.
The country of Ukraine and the Ukrainian
people are of no interest to the United
States. Ukraine is only valuable in as
much as it provides a staging ground (and
the manpower) for Washington to prosecute a
war against Russia.
The clear strategic objective of the
CIA program is to create an
“Afghanistan-type” quagmire for Russia
that will deplete its resources, inflict
massive reputational damage, and kill as
many Russian servicemen as possible.
The ultimate goal of the
CIA-generated insurgency is to destroy
the Russian economy, isolate the Russian
leadership, and send home as many Russian
boys in body-bags as possible in order to
affect a regime change that will replace
arch-rival Putin with a compliant stooge
like Ukrainian Puppet Zelensky.
All the evidence suggests that the
developments on the ground– including the
luring of Russian troops into Ukraine– is
part of a long-standing strategic plan to
prevent the economic integration of Russia
and Europe in order to control China’s
development and preserve US hegemony into
the next century. Thus, current US
foreign policy can be summarized in just 10
words:
“We’ll deal with
Russia first, then move on to China.
French,
translation- Note-
Translation may take a moment to load.
==========================================
*Boonman ziet het vooral als zijn taak om de disfunctionerende VVD premier Rutte en diens kabinetten te prijzen en dat durft zich ook nog journalist te noemen…….
Foto
van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze
hebben de laatste 8 jaar de steden en dorpen van de
zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk
gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al
hebben ze alsnog veel slachtoffers gemaakt onder burgers in die
staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de
omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en
aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag
spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die
hieronder is te vinden.
Hier nog wat links naar berichten over de oneindige VS terreur:‘VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII……..‘
Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5
miljoen moorden aan toegevoegd, moorden begaan door de
VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO
altijd onder militair opperbevel
stond en staat van de VS…)…. Ongelofelijk dat men nooit zal beginnen
over het nemen van sancties tegen de VS, terwijl dat land oneindig veel
meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en
brengt dan Rusland…..
‘VS subsidiëring van neonazi’s in Oekraïne, neonazi’s die ook fascisten uit de VS trainen……‘
(!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi’s
steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO
trouwens de normaalste zaak van de wereld: dat steunen van
fascisten…..) En dan te bedenken dat premier Rutte en minister van
Buitenlandse Zaken Hoekstra onlangs een
krans hebben gelegd bij een monument voor met name omgekomen
neonazi’s…… (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio2.0:
En
nogmaals:
het is de allerhoogste tijd dat journalist Julian Assange wordt
vrijgelaten uit de
smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht
vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS
(toegegeven in officiële gelekte documenten van de VS!!!)……. Het is
zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze
documenten plus beeldmateriaal zijn te vinden in WikiLeaks!!
Foto van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze hebben de laatste 8 jaar de steden en dorpen van de zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al hebben ze alsnog veel slachtoffers gemaakt onder burgers in die staatjes…. Zie ook de NAVO vlag naast een neonazi vlag……. Voor de omgekomen neonazi’s hebben onze zwaar disfunctionerende VVD premier en aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die hieronder is te vinden. 
![34]. “>](https://www.mdpi.com/cimb/cimb-44-00073/article_deploy/html/images/cimb-44-00073-g001.png){kind=link}
***This first source full peer-reviewed article is included with this post below.***
ARTICLE ABSTRACT: These researchers found that messenger RNA (mRNA) from Pfizer’s COVID-19 gene therapy shot is able to enter human liver cells and convert into DNA- combining with the human genome – creating something – NEW – NEVER SEEN BEFORE!!!!!!
THIS IS CAUSE FOR ALARM – ARE HUMANS PATENABLE?
On June 13, 2013 – the US Supreme Court ruled that DNA manipulated by humans are eligible to be patented. This synthetic DNA is produced from messenger RNA that serves as the instructions for making proteins in the cell. Does this sound familiar? (i.e. – mRNA shots) – You can’t write this stuff up.
Again, please read and then share this document/article with as many people you care about as possible. Below in the comments a link to a down loadable pdf has been provided.
FOOD FOR THOUGHT:
WHAT IS INFORMED CONSENT – Point One of The Nuremberg Code – this is taken directly from United States National Institutes of Health:
“1. The voluntary consent of the human subject is absolutely essential. This means that the person involved should have legal capacity to give consent; should be so situated as to be able to exercise free power of choice, without the intervention of any element of force, fraud, deceit, duress, over-reaching, or other ulterior form of constraint or coercion.”